Incidental Mutation 'R2383:BC005561'
ID247602
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104518988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 459 (S459P)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably benign
Transcript: ENSMUST00000096452
AA Change: S459P

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: S459P

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
R7733:BC005561 UTSW 5 104519960 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTACCGAAGAGTTGGTGTCC -3'
(R):5'- TCTTCCACTGTCCATATAAGCG -3'

Sequencing Primer
(F):5'- TTACCGAAGAGTTGGTGTCCCTAAAG -3'
(R):5'- TCCACTGTCCATATAAGCGATATC -3'
Posted On2014-11-11