Incidental Mutation 'R2383:BC048403'
ID247610
Institutional Source Beutler Lab
Gene Symbol BC048403
Ensembl Gene ENSMUSG00000053684
Gene NamecDNA sequence BC048403
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2383 (G1)
Quality Score221
Status Not validated
Chromosome10
Chromosomal Location121739937-121752878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121750649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 290 (T290A)
Ref Sequence ENSEMBL: ENSMUSP00000070834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065600] [ENSMUST00000136432]
PDB Structure
X-ray structure of a hypothetical protein from Mouse Mm.209172 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065600
AA Change: T290A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070834
Gene: ENSMUSG00000053684
AA Change: T290A

DomainStartEndE-ValueType
Pfam:DUF2003 7 444 3.8e-252 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136432
AA Change: T154A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117249
Gene: ENSMUSG00000053684
AA Change: T154A

DomainStartEndE-ValueType
Pfam:DUF2003 1 309 1.1e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138630
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in BC048403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:BC048403 APN 10 121750770 missense probably damaging 1.00
IGL02598:BC048403 APN 10 121739971 utr 5 prime probably benign
IGL02747:BC048403 APN 10 121745550 missense possibly damaging 0.94
R0381:BC048403 UTSW 10 121745375 missense probably damaging 1.00
R0732:BC048403 UTSW 10 121750947 missense possibly damaging 0.55
R4299:BC048403 UTSW 10 121745446 missense probably benign 0.01
R4760:BC048403 UTSW 10 121740007 missense probably damaging 1.00
R5595:BC048403 UTSW 10 121740147 start gained probably benign
R6184:BC048403 UTSW 10 121750905 missense probably damaging 1.00
R6487:BC048403 UTSW 10 121745541 missense probably damaging 1.00
R6977:BC048403 UTSW 10 121745466 missense probably damaging 0.98
R7094:BC048403 UTSW 10 121740193 missense possibly damaging 0.95
R7250:BC048403 UTSW 10 121745471 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGACCTTTGAGAAGCAGCG -3'
(R):5'- AACATTGGGCCAGTGCATG -3'

Sequencing Primer
(F):5'- CTTTGAGAAGCAGCGGGAGAC -3'
(R):5'- ATGACGGGCCTGTCACTG -3'
Posted On2014-11-11