Incidental Mutation 'R2383:Cyp2e1'
ID247605
Institutional Source Beutler Lab
Gene Symbol Cyp2e1
Ensembl Gene ENSMUSG00000025479
Gene Namecytochrome P450, family 2, subfamily e, polypeptide 1
SynonymsCyp2e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140763739-140774987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140770068 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 222 (S222L)
Ref Sequence ENSEMBL: ENSMUSP00000026552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000209253] [ENSMUST00000210235]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
AA Change: S222L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479
AA Change: S222L

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably benign
Transcript: ENSMUST00000210235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210403
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered responses to xenobiotics including decreased urethane-induced tumors and allylnitrile- or acetamenophen-associated mortality but increased allylnitrile-induced vestibular function loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Evx2 T C 2: 74,658,049 probably null Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Cyp2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Cyp2e1 APN 7 140769153 missense probably benign 0.17
IGL01755:Cyp2e1 APN 7 140774556 critical splice acceptor site probably null
IGL01884:Cyp2e1 APN 7 140773750 missense probably benign 0.16
IGL01950:Cyp2e1 APN 7 140764961 critical splice donor site probably null
IGL01964:Cyp2e1 APN 7 140763866 missense probably damaging 1.00
IGL02430:Cyp2e1 APN 7 140770226 missense probably damaging 1.00
IGL02505:Cyp2e1 APN 7 140769156 missense probably damaging 1.00
IGL02596:Cyp2e1 APN 7 140770118 missense probably damaging 0.99
IGL02725:Cyp2e1 APN 7 140763915 missense probably null 1.00
IGL02887:Cyp2e1 APN 7 140763911 missense probably damaging 1.00
IGL03114:Cyp2e1 APN 7 140773129 missense possibly damaging 0.95
IGL03146:Cyp2e1 APN 7 140770221 missense probably benign 0.00
IGL03340:Cyp2e1 APN 7 140764854 missense probably damaging 1.00
R1396:Cyp2e1 UTSW 7 140773079 missense probably damaging 0.98
R2111:Cyp2e1 UTSW 7 140773634 missense probably damaging 1.00
R2230:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2231:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R3778:Cyp2e1 UTSW 7 140763909 missense possibly damaging 0.58
R4082:Cyp2e1 UTSW 7 140771078 missense possibly damaging 0.67
R4707:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4751:Cyp2e1 UTSW 7 140774716 nonsense probably null
R4784:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4792:Cyp2e1 UTSW 7 140773675 missense probably benign
R4917:Cyp2e1 UTSW 7 140774614 missense possibly damaging 0.94
R4934:Cyp2e1 UTSW 7 140770117 missense probably damaging 1.00
R5092:Cyp2e1 UTSW 7 140774735 missense probably damaging 1.00
R5388:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R5423:Cyp2e1 UTSW 7 140770118 missense probably benign 0.01
R6740:Cyp2e1 UTSW 7 140763780 unclassified probably benign
R7065:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R7154:Cyp2e1 UTSW 7 140770137 missense probably damaging 1.00
R8054:Cyp2e1 UTSW 7 140770958 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGGTTGGCTCAGCATCCTTC -3'
(R):5'- CGTCAGACTTGGATGATGCACC -3'

Sequencing Primer
(F):5'- ACTTCAGGATCCGTGTATACTTG -3'
(R):5'- TTGGATGATGCACCCCTGC -3'
Posted On2014-11-11