Incidental Mutation 'R2407:Aldh1a2'
ID248062
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission 040373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2407 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71252598 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 40 (I40F)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect probably damaging
Transcript: ENSMUST00000034723
AA Change: I40F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: I40F

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,228 N149I probably benign Het
4931408C20Rik A T 1: 26,682,838 M1087K possibly damaging Het
Agxt G T 1: 93,135,780 A135S probably benign Het
Ang T A 14: 51,101,646 C81* probably null Het
Apc G T 18: 34,314,262 V1370F possibly damaging Het
Arfgef3 T C 10: 18,677,866 T127A possibly damaging Het
Cd1d1 A G 3: 86,998,182 L168P probably damaging Het
Epb42 C A 2: 121,024,752 V451F probably damaging Het
F5 T A 1: 164,211,872 L2017Q probably damaging Het
Hmcn2 A T 2: 31,335,412 probably null Het
Kif13a G A 13: 46,777,097 P164S probably damaging Het
Kirrel T A 3: 87,084,843 I593F probably benign Het
Lin28b A T 10: 45,381,087 I265N possibly damaging Het
Mctp2 A T 7: 72,200,407 D507E probably benign Het
Morc3 G A 16: 93,844,327 probably null Het
Myo3b T C 2: 70,255,253 Y750H probably damaging Het
Nrp1 T C 8: 128,431,945 S238P probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Otog A G 7: 46,241,540 E41G probably benign Het
Pclo G T 5: 14,678,932 probably benign Het
Pdzd2 T C 15: 12,373,161 D2296G probably damaging Het
Peak1 A G 9: 56,259,226 C473R probably damaging Het
Rad51ap2 T A 12: 11,458,501 M808K probably damaging Het
Sec24b A C 3: 130,002,316 S651A probably benign Het
Slc17a3 G A 13: 23,852,435 probably null Het
Slc4a10 A G 2: 62,313,343 H1074R probably benign Het
Spata31d1b A G 13: 59,716,846 K603E possibly damaging Het
Sptbn4 T A 7: 27,418,098 K409* probably null Het
Tacc2 G A 7: 130,622,040 V152I possibly damaging Het
Tiam2 A G 17: 3,477,261 M65V probably benign Het
Tmem131l G T 3: 83,922,048 Q1100K probably benign Het
Togaram1 T C 12: 64,967,670 M565T probably damaging Het
Trib1 T C 15: 59,654,600 Y340H probably benign Het
Wdr66 A T 5: 123,289,969 M510L probably benign Het
Wdr7 A T 18: 63,760,723 M643L probably benign Het
Zfp51 A T 17: 21,463,831 H236L probably damaging Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTTGGATGAAGCAGCTGTCATG -3'
(R):5'- TGAACCTAAGTTGGCATCTAGAACAC -3'

Sequencing Primer
(F):5'- GCAGCTGTCATGGGAATAGATTC -3'
(R):5'- TGGCATCTAGAACACATATTCATTG -3'
Posted On2014-11-11