Incidental Mutation 'R7253:Aldh1a2'
ID564084
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7253 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71215934 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect probably benign
Transcript: ENSMUST00000034723
AA Change: T30A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: T30A

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,391 H199R not run Het
Ak9 A G 10: 41,432,484 N1804S unknown Het
Akr1c21 C A 13: 4,577,140 T147N probably damaging Het
Alox15 T C 11: 70,345,898 D447G probably damaging Het
Amigo2 T C 15: 97,245,075 I489V probably benign Het
Ano9 A T 7: 141,107,437 Y322N probably damaging Het
Arhgap40 G T 2: 158,547,656 W583L probably benign Het
Atxn2 A G 5: 121,778,021 E430G probably damaging Het
B020004J07Rik A T 4: 101,835,528 V425E probably benign Het
Brip1 T C 11: 86,143,278 Y539C possibly damaging Het
C87436 T A 6: 86,465,808 L454Q probably damaging Het
Casp4 T G 9: 5,324,868 Y227D probably benign Het
Ccdc151 T C 9: 22,002,471 T2A probably damaging Het
Chd4 T A 6: 125,106,592 probably null Het
Chrna10 A G 7: 102,112,086 C433R probably benign Het
Cntln A T 4: 85,118,473 N214I probably damaging Het
Colec12 G A 18: 9,848,922 V367I probably damaging Het
Cyp46a1 T C 12: 108,351,996 I222T probably benign Het
Dagla A T 19: 10,262,581 probably null Het
Dcaf7 C A 11: 106,047,843 probably null Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
E2f7 A G 10: 110,766,303 probably null Het
Fam184a G T 10: 53,698,805 T236K probably benign Het
Fam46a C A 9: 85,326,717 G18C probably benign Het
Glyctk T C 9: 106,155,462 T451A probably damaging Het
Hectd4 A G 5: 121,314,881 K484E possibly damaging Het
Hspbap1 G T 16: 35,817,230 C243F unknown Het
Hspg2 A C 4: 137,519,946 N1160T probably benign Het
Ighv5-8 C T 12: 113,655,108 L48F probably benign Het
Jazf1 C A 6: 52,777,652 E146D probably benign Het
Katnb1 C T 8: 95,095,497 Q284* probably null Het
Kctd18 G T 1: 57,961,956 Y213* probably null Het
Klk1b26 T C 7: 44,014,789 S23P possibly damaging Het
Krt88 T C 15: 101,450,511 L26P probably damaging Het
Lrrc8b G A 5: 105,481,656 V623I probably benign Het
Map3k4 T A 17: 12,272,068 M159L probably benign Het
Mast3 C A 8: 70,789,682 probably null Het
Mier1 G A 4: 103,139,347 probably null Het
Mrpl46 T C 7: 78,781,459 D117G probably damaging Het
Ms4a6b A G 19: 11,520,396 S20G probably benign Het
Mup10 A T 4: 60,582,078 M4K unknown Het
Nlrp5 C T 7: 23,417,391 A180V possibly damaging Het
Nlrx1 T A 9: 44,264,704 probably null Het
Olfr1195 T C 2: 88,683,625 T36A possibly damaging Het
Olfr313 T A 11: 58,817,540 C177* probably null Het
Olfr315 T C 11: 58,778,996 Y290H probably damaging Het
Olfr437 T C 6: 43,167,810 F251L probably damaging Het
Olfr612 C T 7: 103,538,788 A149T probably benign Het
Olfr992 A G 2: 85,399,639 I298T probably benign Het
Otud1 C A 2: 19,658,931 D290E probably damaging Het
Pank4 A G 4: 154,970,920 N249S probably benign Het
Pccb G T 9: 101,031,913 S84R probably benign Het
Pemt A T 11: 59,971,255 H194Q possibly damaging Het
Phtf2 A G 5: 20,765,858 I634T possibly damaging Het
Pias2 T G 18: 77,120,115 I232R probably damaging Het
Plce1 A G 19: 38,698,508 E620G probably damaging Het
Ptpn13 G A 5: 103,565,284 E1758K possibly damaging Het
Ptprq T A 10: 107,608,273 Q1490L probably benign Het
Ptx3 G T 3: 66,224,947 M296I probably benign Het
R3hdm2 C T 10: 127,481,775 P464L probably damaging Het
Rapgef1 A G 2: 29,699,721 E258G possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,915 probably benign Het
Senp8 T C 9: 59,737,195 N226S probably benign Het
Six5 C T 7: 19,094,976 R114C probably damaging Het
Slc10a1 T C 12: 80,958,184 T195A probably benign Het
Slpi G T 2: 164,355,547 Q51K probably benign Het
Smarca4 T C 9: 21,658,960 V753A probably benign Het
Tbc1d32 C A 10: 56,198,441 M225I probably benign Het
Tnfrsf21 G A 17: 43,037,667 V57I probably benign Het
Trim44 G T 2: 102,346,968 P336T possibly damaging Het
Txlnb A G 10: 17,827,885 I264V probably damaging Het
Wisp3 T G 10: 39,155,035 N164T probably benign Het
Xirp2 A C 2: 67,513,482 E2022D probably benign Het
Zfp975 A G 7: 42,661,612 *526R probably null Het
Zp1 A G 19: 10,916,569 L424P probably damaging Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCCGCACGTCCAATAAGAAG -3'
(R):5'- ATAGGGGACTCCAGAACCAGAC -3'

Sequencing Primer
(F):5'- CGTCCAATAAGAAGCGCCC -3'
(R):5'- AGGTCTGCTCTGGGAAATCC -3'
Posted On2019-06-26