Incidental Mutation 'R2567:Mgat4c'
ID254567
Institutional Source Beutler Lab
Gene Symbol Mgat4c
Ensembl Gene ENSMUSG00000019888
Gene NameMGAT4 family, member C
Synonyms9130411I17Rik
MMRRC Submission 040426-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2567 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location101681487-102391469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102378262 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 35 (F35L)
Ref Sequence ENSEMBL: ENSMUSP00000116216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020039] [ENSMUST00000120748] [ENSMUST00000127504] [ENSMUST00000138016] [ENSMUST00000138522] [ENSMUST00000156751] [ENSMUST00000163753] [ENSMUST00000179929] [ENSMUST00000219195]
Predicted Effect probably benign
Transcript: ENSMUST00000020039
AA Change: F35L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020039
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120748
AA Change: F35L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114010
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127504
AA Change: F35L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117148
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134930
Predicted Effect probably benign
Transcript: ENSMUST00000138016
Predicted Effect probably benign
Transcript: ENSMUST00000138522
AA Change: F35L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118056
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
Pfam:Glyco_transf_54 43 150 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156751
AA Change: F35L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116216
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163753
AA Change: F35L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131551
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179929
AA Change: F35L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135959
Gene: ENSMUSG00000019888
AA Change: F35L

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 52 330 1.1e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218984
Predicted Effect probably benign
Transcript: ENSMUST00000219195
AA Change: F35L

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,251 D409G probably benign Het
Akap10 A G 11: 61,893,349 probably benign Het
Akap6 G T 12: 52,938,373 S863I probably damaging Het
Ap1s3 T C 1: 79,625,204 K29E possibly damaging Het
Atm T A 9: 53,457,470 I2341L possibly damaging Het
Atp12a A T 14: 56,386,927 D944V probably damaging Het
Baz2b A T 2: 59,913,911 S1417T possibly damaging Het
C130079G13Rik A G 3: 59,929,054 probably benign Het
Cacna1a T A 8: 84,549,725 M613K probably damaging Het
Ccdc191 A C 16: 43,943,967 probably null Het
Cd209d T A 8: 3,876,327 N96I probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk4 T G 10: 127,064,276 V14G probably benign Het
Chrna10 C A 7: 102,112,069 M438I probably benign Het
Clec10a T C 11: 70,169,532 probably null Het
Cog3 A G 14: 75,754,290 V40A probably benign Het
Creb3l3 T C 10: 81,086,049 H315R probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cubn A G 2: 13,278,356 probably null Het
Cygb T C 11: 116,649,866 D98G probably damaging Het
Dmbx1 T C 4: 115,920,292 K120E probably damaging Het
Dnah3 T A 7: 119,952,697 I2800F possibly damaging Het
Dntt G T 19: 41,041,336 R245L possibly damaging Het
Dock1 T G 7: 135,145,484 V1508G probably damaging Het
Enpp4 A C 17: 44,101,845 I266R probably damaging Het
Fhl4 T C 10: 85,098,780 I46V possibly damaging Het
Fn1 G A 1: 71,597,736 Q1995* probably null Het
Foxo1 T A 3: 52,269,334 L178H probably damaging Het
Galnt18 C T 7: 111,554,616 R267H probably damaging Het
Gm1110 T C 9: 26,920,696 D53G probably benign Het
Gm12666 T C 4: 92,191,323 E87G probably benign Het
Gm5294 A G 5: 138,820,185 S36G probably null Het
Gm7104 A T 12: 88,285,472 noncoding transcript Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Haus6 C A 4: 86,585,885 E501* probably null Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Kdelr3 A G 15: 79,522,831 I38V probably benign Het
Lamb1 A G 12: 31,269,055 probably null Het
Mmab A T 5: 114,433,317 M166K probably benign Het
Mrpl2 A G 17: 46,647,501 T70A probably benign Het
Naa11 C T 5: 97,391,759 G180D probably benign Het
Npy6r T C 18: 44,275,821 V103A possibly damaging Het
Nup188 A T 2: 30,341,782 R1463W possibly damaging Het
Nusap1 T A 2: 119,643,830 S336R possibly damaging Het
Olfr876 T A 9: 37,804,213 F101I probably damaging Het
Pabpc4 T A 4: 123,297,951 L589Q probably damaging Het
Pcdh12 T A 18: 38,282,096 N659Y probably damaging Het
Perm1 T C 4: 156,217,118 S40P probably damaging Het
Phldb1 T C 9: 44,726,025 T114A probably damaging Het
Pirt C T 11: 66,926,159 L99F probably damaging Het
Plxdc2 A G 2: 16,712,184 R360G probably benign Het
Rhpn2 G A 7: 35,381,532 probably null Het
Rpusd2 T A 2: 119,037,075 I268N probably damaging Het
Sds G T 5: 120,481,581 W185L probably damaging Het
Serpinb5 A G 1: 106,875,146 K137R probably benign Het
Sh3pxd2a A G 19: 47,424,569 V25A possibly damaging Het
Slc1a2 C T 2: 102,767,010 T454I probably damaging Het
Slc25a40 T C 5: 8,430,459 C70R probably damaging Het
Smoc1 G A 12: 81,167,590 E260K probably damaging Het
Sparcl1 A T 5: 104,085,088 F616I probably damaging Het
Ssc5d A T 7: 4,936,335 D590V probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm2 C T 10: 77,941,174 V430M probably damaging Het
Ttn T C 2: 76,744,328 D25407G probably damaging Het
Vmn2r68 T C 7: 85,234,595 I101V probably benign Het
Xrcc4 A T 13: 90,062,142 M61K probably damaging Het
Zfp648 A G 1: 154,204,949 T285A probably damaging Het
Other mutations in Mgat4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mgat4c APN 10 102388720 missense probably damaging 1.00
IGL01293:Mgat4c APN 10 102388225 missense probably benign 0.00
IGL01394:Mgat4c APN 10 102385114 missense possibly damaging 0.62
IGL01525:Mgat4c APN 10 102378196 missense probably damaging 0.97
IGL02023:Mgat4c APN 10 102378184 nonsense probably null
IGL02150:Mgat4c APN 10 102389122 missense probably benign 0.08
IGL02296:Mgat4c APN 10 102385160 splice site probably benign
IGL02946:Mgat4c APN 10 102389253 missense probably benign 0.14
IGL03062:Mgat4c APN 10 102388461 missense probably damaging 1.00
R0001:Mgat4c UTSW 10 102388956 missense probably benign 0.01
R0326:Mgat4c UTSW 10 102388704 missense probably damaging 1.00
R0480:Mgat4c UTSW 10 102389119 missense probably damaging 0.97
R0656:Mgat4c UTSW 10 102388591 missense probably damaging 1.00
R0746:Mgat4c UTSW 10 102388687 missense probably damaging 1.00
R1639:Mgat4c UTSW 10 102378281 missense probably damaging 1.00
R1989:Mgat4c UTSW 10 102378159 start codon destroyed probably null 0.66
R2148:Mgat4c UTSW 10 102388929 missense probably benign
R2437:Mgat4c UTSW 10 102388575 missense probably damaging 1.00
R3780:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3781:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3782:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3786:Mgat4c UTSW 10 102385070 missense probably damaging 1.00
R3806:Mgat4c UTSW 10 102388360 missense probably benign 0.10
R4596:Mgat4c UTSW 10 102388561 missense probably damaging 1.00
R4718:Mgat4c UTSW 10 102388606 missense probably damaging 1.00
R4740:Mgat4c UTSW 10 102388404 missense probably damaging 1.00
R4872:Mgat4c UTSW 10 102388738 missense probably damaging 1.00
R5305:Mgat4c UTSW 10 102389279 missense possibly damaging 0.82
R5740:Mgat4c UTSW 10 102389321 missense possibly damaging 0.49
R5841:Mgat4c UTSW 10 102388965 missense probably damaging 0.98
R6367:Mgat4c UTSW 10 102385154 critical splice donor site probably null
R6459:Mgat4c UTSW 10 102385127 missense probably damaging 1.00
R7021:Mgat4c UTSW 10 102388428 missense possibly damaging 0.82
R7122:Mgat4c UTSW 10 102378209 nonsense probably null
R7146:Mgat4c UTSW 10 102388496 missense probably damaging 1.00
R7629:Mgat4c UTSW 10 102389070 missense probably benign 0.03
R7877:Mgat4c UTSW 10 102385039 missense probably benign 0.00
R7960:Mgat4c UTSW 10 102385039 missense probably benign 0.00
RF020:Mgat4c UTSW 10 102389067 missense probably benign
X0020:Mgat4c UTSW 10 102388390 missense possibly damaging 0.67
Z1177:Mgat4c UTSW 10 102388450 missense probably damaging 1.00
Z1177:Mgat4c UTSW 10 102388602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAAACTGGAAACACCTAGTAAT -3'
(R):5'- TATGGCTAAATGTATACAGACAGGA -3'

Sequencing Primer
(F):5'- CTTGATAAACGTCAACATTATGCATG -3'
(R):5'- TGTATACAGACAGGAAATATGCAAAC -3'
Posted On2014-12-04