Mutagenetix > Incidental Mutations

Incidental Mutation 'R3781:Mgat4c'

272052

Institutional Source

Beutler Lab

Gene Symbol

Mgat4c

Ensembl Gene

ENSMUSG00000019888

Gene Name

MGAT4 family, member C

Synonyms

9130411I17Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3781 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101681487-102391469 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102388921 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 332 (E332G)

Ref Sequence

ENSEMBL: ENSMUSP00000135959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020039] [ENSMUST00000120748] [ENSMUST00000127504] [ENSMUST00000138522] [ENSMUST00000156751] [ENSMUST00000163753] [ENSMUST00000179929] [ENSMUST00000219195]

Predicted Effect

probably benign
Transcript: ENSMUST00000020039
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000020039
Gene: ENSMUSG00000019888
AA Change: E332G

Domain	Start	End	E-Value	Type
transmembrane domain	26	43	N/A	INTRINSIC
Pfam:Glyco_transf_54	44	330	5.3e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120748
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114010
Gene: ENSMUSG00000019888
AA Change: E332G

Domain	Start	End	E-Value	Type
transmembrane domain	26	43	N/A	INTRINSIC
Pfam:Glyco_transf_54	44	330	5.3e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127504

SMART Domains

Protein: ENSMUSP00000117148
Gene: ENSMUSG00000019888

Domain	Start	End	E-Value	Type
transmembrane domain	26	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138522

SMART Domains

Protein: ENSMUSP00000118056
Gene: ENSMUSG00000019888

Domain	Start	End	E-Value	Type
low complexity region	26	38	N/A	INTRINSIC
Pfam:Glyco_transf_54	43	150	1.5e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156751

SMART Domains

Protein: ENSMUSP00000116216
Gene: ENSMUSG00000019888

Domain	Start	End	E-Value	Type
transmembrane domain	26	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163753
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131551
Gene: ENSMUSG00000019888
AA Change: E332G

Domain	Start	End	E-Value	Type
transmembrane domain	26	43	N/A	INTRINSIC
Pfam:Glyco_transf_54	44	330	5.3e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179929
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000135959
Gene: ENSMUSG00000019888
AA Change: E332G

Domain	Start	End	E-Value	Type
transmembrane domain	26	43	N/A	INTRINSIC
Pfam:Glyco_transf_54	52	330	1.1e-96	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000219195

Meta Mutation Damage Score

0.1519

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bap1	T	C	14: 31,257,618	I526T	possibly damaging	Het
Calcr	T	C	6: 3,700,193	T263A	possibly damaging	Het
Cdh7	T	A	1: 110,049,004	V133E	probably benign	Het
Ddx5	T	C	11: 106,784,520	I330V	probably benign	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Gnl2	T	C	4: 125,037,606	V110A	probably damaging	Het
H2-Q10	A	G	17: 35,471,018	Y179C	possibly damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Map3k20	A	G	2: 72,402,355		probably benign	Het
Mcm7	G	A	5: 138,164,736	R385W	probably damaging	Het
Nudt3	A	G	17: 27,580,808	S134P	possibly damaging	Het
Olfr1186	A	T	2: 88,526,365	T261S	probably benign	Het
Olfr1212	G	T	2: 88,958,747	E94*	probably null	Het
Olfr385	C	A	11: 73,589,013	G242C	probably damaging	Het
Olfr385	A	T	11: 73,589,368	Y123*	probably null	Het
Olfr573-ps1	T	C	7: 102,942,071	I169V	probably benign	Het
Pcnx	A	G	12: 81,996,118	T2325A	probably benign	Het
Plekha6	A	G	1: 133,294,655	E993G	probably damaging	Het
Psmd4	T	A	3: 95,036,728	Y15F	probably benign	Het
Rad23b	C	T	4: 55,382,586	T263M	probably damaging	Het
Stpg3	T	A	2: 25,213,863	M154L	probably benign	Het
Vmn1r45	C	A	6: 89,933,817	R57L	probably benign	Het
Zfp658	G	A	7: 43,573,846	R515H	probably benign	Het

Other mutations in Mgat4c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Mgat4c	APN	10	102388720	missense	probably damaging	1.00
IGL01293:Mgat4c	APN	10	102388225	missense	probably benign	0.00
IGL01394:Mgat4c	APN	10	102385114	missense	possibly damaging	0.62
IGL01525:Mgat4c	APN	10	102378196	missense	probably damaging	0.97
IGL02023:Mgat4c	APN	10	102378184	nonsense	probably null
IGL02150:Mgat4c	APN	10	102389122	missense	probably benign	0.08
IGL02296:Mgat4c	APN	10	102385160	splice site	probably benign
IGL02946:Mgat4c	APN	10	102389253	missense	probably benign	0.14
IGL03062:Mgat4c	APN	10	102388461	missense	probably damaging	1.00
R0001:Mgat4c	UTSW	10	102388956	missense	probably benign	0.01
R0326:Mgat4c	UTSW	10	102388704	missense	probably damaging	1.00
R0480:Mgat4c	UTSW	10	102389119	missense	probably damaging	0.97
R0656:Mgat4c	UTSW	10	102388591	missense	probably damaging	1.00
R0746:Mgat4c	UTSW	10	102388687	missense	probably damaging	1.00
R1639:Mgat4c	UTSW	10	102378281	missense	probably damaging	1.00
R1989:Mgat4c	UTSW	10	102378159	start codon destroyed	probably null	0.66
R2148:Mgat4c	UTSW	10	102388929	missense	probably benign
R2437:Mgat4c	UTSW	10	102388575	missense	probably damaging	1.00
R2567:Mgat4c	UTSW	10	102378262	missense	probably benign	0.38
R3780:Mgat4c	UTSW	10	102388921	missense	probably benign	0.25
R3782:Mgat4c	UTSW	10	102388921	missense	probably benign	0.25
R3786:Mgat4c	UTSW	10	102385070	missense	probably damaging	1.00
R3806:Mgat4c	UTSW	10	102388360	missense	probably benign	0.10
R4596:Mgat4c	UTSW	10	102388561	missense	probably damaging	1.00
R4718:Mgat4c	UTSW	10	102388606	missense	probably damaging	1.00
R4740:Mgat4c	UTSW	10	102388404	missense	probably damaging	1.00
R4872:Mgat4c	UTSW	10	102388738	missense	probably damaging	1.00
R5305:Mgat4c	UTSW	10	102389279	missense	possibly damaging	0.82
R5740:Mgat4c	UTSW	10	102389321	missense	possibly damaging	0.49
R5841:Mgat4c	UTSW	10	102388965	missense	probably damaging	0.98
R6367:Mgat4c	UTSW	10	102385154	critical splice donor site	probably null
R6459:Mgat4c	UTSW	10	102385127	missense	probably damaging	1.00
R7021:Mgat4c	UTSW	10	102388428	missense	possibly damaging	0.82
R7122:Mgat4c	UTSW	10	102378209	nonsense	probably null
R7146:Mgat4c	UTSW	10	102388496	missense	probably damaging	1.00
R7629:Mgat4c	UTSW	10	102389070	missense	probably benign	0.03
R7877:Mgat4c	UTSW	10	102385039	missense	probably benign	0.00
RF020:Mgat4c	UTSW	10	102389067	missense	probably benign
X0020:Mgat4c	UTSW	10	102388390	missense	possibly damaging	0.67
Z1177:Mgat4c	UTSW	10	102388450	missense	probably damaging	1.00
Z1177:Mgat4c	UTSW	10	102388602	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTCTGGCCCATTTCTTATTAATG -3'
(R):5'- AAGATGTCATTCTGCCGGTC -3'

Sequencing Primer
(F):5'- GTTCTATCAAGAAATGCCCTGCG -3'
(R):5'- GCCGGTCCTCTGTTCCAG -3'

Posted On

2015-03-25