Incidental Mutation 'R3781:Mgat4c'
ID272052
Institutional Source Beutler Lab
Gene Symbol Mgat4c
Ensembl Gene ENSMUSG00000019888
Gene NameMGAT4 family, member C
Synonyms9130411I17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location101681487-102391469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102388921 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 332 (E332G)
Ref Sequence ENSEMBL: ENSMUSP00000135959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020039] [ENSMUST00000120748] [ENSMUST00000127504] [ENSMUST00000138522] [ENSMUST00000156751] [ENSMUST00000163753] [ENSMUST00000179929] [ENSMUST00000219195]
Predicted Effect probably benign
Transcript: ENSMUST00000020039
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020039
Gene: ENSMUSG00000019888
AA Change: E332G

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120748
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114010
Gene: ENSMUSG00000019888
AA Change: E332G

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127504
SMART Domains Protein: ENSMUSP00000117148
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138522
SMART Domains Protein: ENSMUSP00000118056
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
Pfam:Glyco_transf_54 43 150 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156751
SMART Domains Protein: ENSMUSP00000116216
Gene: ENSMUSG00000019888

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163753
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131551
Gene: ENSMUSG00000019888
AA Change: E332G

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 44 330 5.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179929
AA Change: E332G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135959
Gene: ENSMUSG00000019888
AA Change: E332G

DomainStartEndE-ValueType
transmembrane domain 26 43 N/A INTRINSIC
Pfam:Glyco_transf_54 52 330 1.1e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219195
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Mgat4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mgat4c APN 10 102388720 missense probably damaging 1.00
IGL01293:Mgat4c APN 10 102388225 missense probably benign 0.00
IGL01394:Mgat4c APN 10 102385114 missense possibly damaging 0.62
IGL01525:Mgat4c APN 10 102378196 missense probably damaging 0.97
IGL02023:Mgat4c APN 10 102378184 nonsense probably null
IGL02150:Mgat4c APN 10 102389122 missense probably benign 0.08
IGL02296:Mgat4c APN 10 102385160 splice site probably benign
IGL02946:Mgat4c APN 10 102389253 missense probably benign 0.14
IGL03062:Mgat4c APN 10 102388461 missense probably damaging 1.00
R0001:Mgat4c UTSW 10 102388956 missense probably benign 0.01
R0326:Mgat4c UTSW 10 102388704 missense probably damaging 1.00
R0480:Mgat4c UTSW 10 102389119 missense probably damaging 0.97
R0656:Mgat4c UTSW 10 102388591 missense probably damaging 1.00
R0746:Mgat4c UTSW 10 102388687 missense probably damaging 1.00
R1639:Mgat4c UTSW 10 102378281 missense probably damaging 1.00
R1989:Mgat4c UTSW 10 102378159 start codon destroyed probably null 0.66
R2148:Mgat4c UTSW 10 102388929 missense probably benign
R2437:Mgat4c UTSW 10 102388575 missense probably damaging 1.00
R2567:Mgat4c UTSW 10 102378262 missense probably benign 0.38
R3780:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3782:Mgat4c UTSW 10 102388921 missense probably benign 0.25
R3786:Mgat4c UTSW 10 102385070 missense probably damaging 1.00
R3806:Mgat4c UTSW 10 102388360 missense probably benign 0.10
R4596:Mgat4c UTSW 10 102388561 missense probably damaging 1.00
R4718:Mgat4c UTSW 10 102388606 missense probably damaging 1.00
R4740:Mgat4c UTSW 10 102388404 missense probably damaging 1.00
R4872:Mgat4c UTSW 10 102388738 missense probably damaging 1.00
R5305:Mgat4c UTSW 10 102389279 missense possibly damaging 0.82
R5740:Mgat4c UTSW 10 102389321 missense possibly damaging 0.49
R5841:Mgat4c UTSW 10 102388965 missense probably damaging 0.98
R6367:Mgat4c UTSW 10 102385154 critical splice donor site probably null
R6459:Mgat4c UTSW 10 102385127 missense probably damaging 1.00
R7021:Mgat4c UTSW 10 102388428 missense possibly damaging 0.82
R7122:Mgat4c UTSW 10 102378209 nonsense probably null
R7146:Mgat4c UTSW 10 102388496 missense probably damaging 1.00
R7629:Mgat4c UTSW 10 102389070 missense probably benign 0.03
R7877:Mgat4c UTSW 10 102385039 missense probably benign 0.00
RF020:Mgat4c UTSW 10 102389067 missense probably benign
X0020:Mgat4c UTSW 10 102388390 missense possibly damaging 0.67
Z1177:Mgat4c UTSW 10 102388450 missense probably damaging 1.00
Z1177:Mgat4c UTSW 10 102388602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCTGGCCCATTTCTTATTAATG -3'
(R):5'- AAGATGTCATTCTGCCGGTC -3'

Sequencing Primer
(F):5'- GTTCTATCAAGAAATGCCCTGCG -3'
(R):5'- GCCGGTCCTCTGTTCCAG -3'
Posted On2015-03-25