Incidental Mutation 'R2919:Olfr690'
ID255425
Institutional Source Beutler Lab
Gene Symbol Olfr690
Ensembl Gene ENSMUSG00000050266
Gene Nameolfactory receptor 690
SynonymsGA_x6K02T2PBJ9-7959171-7958224, MOR31-2
MMRRC Submission 040504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2919 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105328225-105334104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105329860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 111 (V111M)
Ref Sequence ENSEMBL: ENSMUSP00000150831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061920] [ENSMUST00000211006] [ENSMUST00000216230]
Predicted Effect probably damaging
Transcript: ENSMUST00000061920
AA Change: V111M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061272
Gene: ENSMUSG00000050266
AA Change: V111M

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 33 312 2e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.4e-9 PFAM
Pfam:7tm_1 43 294 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209868
Predicted Effect probably damaging
Transcript: ENSMUST00000211006
AA Change: V111M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216230
AA Change: V111M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,185,191 R27H probably benign Het
2310002L09Rik A T 4: 73,950,608 L31Q probably damaging Het
Agbl1 G A 7: 76,414,658 D53N probably damaging Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Als2cl A T 9: 110,897,499 probably null Het
Atg9b T A 5: 24,391,544 T125S possibly damaging Het
Casp8ap2 A G 4: 32,645,343 D1472G probably damaging Het
Cd1d2 C G 3: 86,987,680 P158A probably damaging Het
Cdc45 A G 16: 18,808,793 I94T probably benign Het
Chd6 T G 2: 160,967,880 D1487A possibly damaging Het
Edem2 T C 2: 155,709,027 Y340C probably damaging Het
Fbxl12 C T 9: 20,642,213 R26H probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Gm5884 A G 6: 128,645,058 noncoding transcript Het
Inpp4b C A 8: 81,985,329 A425E possibly damaging Het
Kif1a A G 1: 93,046,742 Y964H probably damaging Het
Lrp1b A C 2: 41,770,899 C66G probably damaging Het
Lrp4 A G 2: 91,490,730 I1034V probably benign Het
Mmrn2 T C 14: 34,402,922 V820A possibly damaging Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mroh9 A C 1: 163,056,772 M399R probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp2 G A 5: 65,807,098 G830D probably benign Het
Nagpa G A 16: 5,203,787 probably benign Het
Olfr1000 G A 2: 85,608,410 P167S probably benign Het
Oxgr1 T A 14: 120,022,809 probably benign Het
Parp3 T A 9: 106,473,725 R323W possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Pfkp C T 13: 6,593,243 G513D probably damaging Het
Pla2g4d T C 2: 120,281,627 probably benign Het
Rtl1 T C 12: 109,591,148 E1419G unknown Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Sgk2 T G 2: 162,999,195 L175R probably damaging Het
Sgk2 C A 2: 162,999,205 F178L probably damaging Het
Sim1 T C 10: 50,909,815 Y255H probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc38a3 A T 9: 107,657,687 I163N probably damaging Het
Slc39a4 A G 15: 76,616,670 L31P probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Slfnl1 G T 4: 120,533,078 probably benign Het
Stradb G A 1: 58,992,669 V247M probably benign Het
Styk1 T A 6: 131,313,004 probably benign Het
Sult1d1 A G 5: 87,559,755 probably benign Het
Syk C T 13: 52,611,121 P95S probably benign Het
Taar2 T A 10: 23,941,556 N331K probably benign Het
Thsd7b A G 1: 130,189,850 probably benign Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tmbim7 G A 5: 3,673,188 probably null Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Tmem184c A T 8: 77,604,647 C158S probably damaging Het
Tmpo A G 10: 91,152,686 I310T probably benign Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Xirp1 T C 9: 120,018,701 E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 E198G probably damaging Het
Zfp804a A G 2: 82,235,816 N44D probably damaging Het
Other mutations in Olfr690
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Olfr690 APN 7 105329382 missense possibly damaging 0.95
IGL01403:Olfr690 APN 7 105329398 missense probably benign 0.01
IGL01546:Olfr690 APN 7 105329692 missense probably damaging 1.00
IGL02936:Olfr690 APN 7 105330005 nonsense probably null
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R1425:Olfr690 UTSW 7 105329715 missense probably damaging 1.00
R1911:Olfr690 UTSW 7 105329383 missense probably benign 0.11
R2126:Olfr690 UTSW 7 105329252 nonsense probably null
R2511:Olfr690 UTSW 7 105329610 missense probably damaging 1.00
R3755:Olfr690 UTSW 7 105330151 missense probably damaging 1.00
R4152:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4153:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4154:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4247:Olfr690 UTSW 7 105330148 missense probably benign
R5015:Olfr690 UTSW 7 105329604 missense possibly damaging 0.61
R5143:Olfr690 UTSW 7 105329524 missense probably damaging 1.00
R5642:Olfr690 UTSW 7 105329565 missense probably damaging 1.00
R6747:Olfr690 UTSW 7 105330027 missense probably benign 0.00
R6961:Olfr690 UTSW 7 105329706 missense probably damaging 1.00
R7074:Olfr690 UTSW 7 105329268 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATGACAGCCTCTTCAGCAG -3'
(R):5'- TACATTGCTGCAGTCTTGGG -3'

Sequencing Primer
(F):5'- GCCTCTTCAGCAGAAATATGATAGG -3'
(R):5'- TTGTCCTGAGTGAACGCAC -3'
Posted On2014-12-29