Mutagenetix > Incidental Mutations

Incidental Mutation 'R2919:Chd6'

255408

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

040504-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.684) question?

Stock #

R2919 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 160967880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1487 (D1487A)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039782
AA Change: D1487A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: D1487A

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137152

Meta Mutation Damage Score

0.1011

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	C	T	5: 146,185,191	R27H	probably benign	Het
2310002L09Rik	A	T	4: 73,950,608	L31Q	probably damaging	Het
Agbl1	G	A	7: 76,414,658	D53N	probably damaging	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Als2cl	A	T	9: 110,897,499		probably null	Het
Atg9b	T	A	5: 24,391,544	T125S	possibly damaging	Het
Casp8ap2	A	G	4: 32,645,343	D1472G	probably damaging	Het
Cd1d2	C	G	3: 86,987,680	P158A	probably damaging	Het
Cdc45	A	G	16: 18,808,793	I94T	probably benign	Het
Edem2	T	C	2: 155,709,027	Y340C	probably damaging	Het
Fbxl12	C	T	9: 20,642,213	R26H	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Gm5884	A	G	6: 128,645,058		noncoding transcript	Het
Inpp4b	C	A	8: 81,985,329	A425E	possibly damaging	Het
Kif1a	A	G	1: 93,046,742	Y964H	probably damaging	Het
Lrp1b	A	C	2: 41,770,899	C66G	probably damaging	Het
Lrp4	A	G	2: 91,490,730	I1034V	probably benign	Het
Mmrn2	T	C	14: 34,402,922	V820A	possibly damaging	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mroh9	A	C	1: 163,056,772	M399R	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
N4bp2	G	A	5: 65,807,098	G830D	probably benign	Het
Nagpa	G	A	16: 5,203,787		probably benign	Het
Olfr1000	G	A	2: 85,608,410	P167S	probably benign	Het
Olfr690	C	T	7: 105,329,860	V111M	probably damaging	Het
Oxgr1	T	A	14: 120,022,809		probably benign	Het
Parp3	T	A	9: 106,473,725	R323W	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Pfkp	C	T	13: 6,593,243	G513D	probably damaging	Het
Pla2g4d	T	C	2: 120,281,627		probably benign	Het
Rtl1	T	C	12: 109,591,148	E1419G	unknown	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Sgk2	T	G	2: 162,999,195	L175R	probably damaging	Het
Sgk2	C	A	2: 162,999,205	F178L	probably damaging	Het
Sim1	T	C	10: 50,909,815	Y255H	probably benign	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc38a3	A	T	9: 107,657,687	I163N	probably damaging	Het
Slc39a4	A	G	15: 76,616,670	L31P	probably damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Slfnl1	G	T	4: 120,533,078		probably benign	Het
Stradb	G	A	1: 58,992,669	V247M	probably benign	Het
Styk1	T	A	6: 131,313,004		probably benign	Het
Sult1d1	A	G	5: 87,559,755		probably benign	Het
Syk	C	T	13: 52,611,121	P95S	probably benign	Het
Taar2	T	A	10: 23,941,556	N331K	probably benign	Het
Thsd7b	A	G	1: 130,189,850		probably benign	Het
Tldc1	G	A	8: 119,768,317	A234V	probably benign	Het
Tmbim7	G	A	5: 3,673,188		probably null	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Tmem184c	A	T	8: 77,604,647	C158S	probably damaging	Het
Tmpo	A	G	10: 91,152,686	I310T	probably benign	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Xirp1	T	C	9: 120,018,701	E372G	possibly damaging	Het
Zbtb5	T	C	4: 44,994,790	E198G	probably damaging	Het
Zfp804a	A	G	2: 82,235,816	N44D	probably damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGAGCTGTACCTTTTGGG -3'
(R):5'- CATCGTCATGAGGGAAAGGC -3'

Sequencing Primer
(F):5'- GACAGAGGCATTTTTATAGCTCAGC -3'
(R):5'- TTGAACTCAAGGCCAGCTTG -3'

Posted On

2014-12-29