Incidental Mutation 'R2919:Chd6'
ID 255408
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 5430439G14Rik, 6330406J24Rik
MMRRC Submission 040504-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.755) question?
Stock # R2919 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 160788898-160950995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 160809800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1487 (D1487A)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000039782
AA Change: D1487A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: D1487A

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137152
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,122,001 (GRCm39) R27H probably benign Het
2310002L09Rik A T 4: 73,868,845 (GRCm39) L31Q probably damaging Het
Agbl1 G A 7: 76,064,406 (GRCm39) D53N probably damaging Het
Aloxe3 C T 11: 69,033,749 (GRCm39) T621I probably damaging Het
Als2cl A T 9: 110,726,567 (GRCm39) probably null Het
Atg9b T A 5: 24,596,542 (GRCm39) T125S possibly damaging Het
Casp8ap2 A G 4: 32,645,343 (GRCm39) D1472G probably damaging Het
Cd1d2 C G 3: 86,894,987 (GRCm39) P158A probably damaging Het
Cdc45 A G 16: 18,627,543 (GRCm39) I94T probably benign Het
Edem2 T C 2: 155,550,947 (GRCm39) Y340C probably damaging Het
Fbxl12 C T 9: 20,553,509 (GRCm39) R26H probably damaging Het
Fgfr3 A G 5: 33,891,284 (GRCm39) N516S probably damaging Het
Gm5884 A G 6: 128,622,021 (GRCm39) noncoding transcript Het
Hdac1-ps A G 17: 78,800,275 (GRCm39) D422G probably damaging Het
Inpp4b C A 8: 82,711,958 (GRCm39) A425E possibly damaging Het
Kif1a A G 1: 92,974,464 (GRCm39) Y964H probably damaging Het
Lrp1b A C 2: 41,660,911 (GRCm39) C66G probably damaging Het
Lrp4 A G 2: 91,321,075 (GRCm39) I1034V probably benign Het
Meak7 G A 8: 120,495,056 (GRCm39) A234V probably benign Het
Mmrn2 T C 14: 34,124,879 (GRCm39) V820A possibly damaging Het
Mphosph9 G A 5: 124,399,069 (GRCm39) T982I probably benign Het
Mroh9 A C 1: 162,884,341 (GRCm39) M399R probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
N4bp2 G A 5: 65,964,441 (GRCm39) G830D probably benign Het
Nagpa G A 16: 5,021,651 (GRCm39) probably benign Het
Or52b1 C T 7: 104,979,067 (GRCm39) V111M probably damaging Het
Or5g23 G A 2: 85,438,754 (GRCm39) P167S probably benign Het
Oxgr1 T A 14: 120,260,221 (GRCm39) probably benign Het
Parp3 T A 9: 106,350,924 (GRCm39) R323W possibly damaging Het
Pfkfb3 C T 2: 11,489,138 (GRCm39) V286I probably benign Het
Pfkp C T 13: 6,643,279 (GRCm39) G513D probably damaging Het
Pla2g4d T C 2: 120,112,108 (GRCm39) probably benign Het
Rtl1 T C 12: 109,557,582 (GRCm39) E1419G unknown Het
Sdf2 G C 11: 78,145,680 (GRCm39) V126L probably damaging Het
Sgk2 T G 2: 162,841,115 (GRCm39) L175R probably damaging Het
Sgk2 C A 2: 162,841,125 (GRCm39) F178L probably damaging Het
Sim1 T C 10: 50,785,911 (GRCm39) Y255H probably benign Het
Slc13a5 T C 11: 72,138,617 (GRCm39) E442G possibly damaging Het
Slc38a3 A T 9: 107,534,886 (GRCm39) I163N probably damaging Het
Slc39a4 A G 15: 76,500,870 (GRCm39) L31P probably damaging Het
Slc5a11 GGTGC G 7: 122,838,595 (GRCm39) probably null Het
Slfnl1 G T 4: 120,390,275 (GRCm39) probably benign Het
Stradb G A 1: 59,031,828 (GRCm39) V247M probably benign Het
Styk1 T A 6: 131,289,967 (GRCm39) probably benign Het
Sult1d1 A G 5: 87,707,614 (GRCm39) probably benign Het
Syk C T 13: 52,765,157 (GRCm39) P95S probably benign Het
Taar2 T A 10: 23,817,454 (GRCm39) N331K probably benign Het
Thsd7b A G 1: 130,117,587 (GRCm39) probably benign Het
Tmbim7 G A 5: 3,723,188 (GRCm39) probably null Het
Tmem107 T C 11: 68,962,247 (GRCm39) L68P probably damaging Het
Tmem184c A T 8: 78,331,276 (GRCm39) C158S probably damaging Het
Tmpo A G 10: 90,988,548 (GRCm39) I310T probably benign Het
Ugt2b5 A G 5: 87,273,266 (GRCm39) F467L possibly damaging Het
Xirp1 T C 9: 119,847,767 (GRCm39) E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 (GRCm39) E198G probably damaging Het
Zfp804a A G 2: 82,066,160 (GRCm39) N44D probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 160,883,999 (GRCm39) missense probably benign 0.01
IGL00899:Chd6 APN 2 160,871,218 (GRCm39) splice site probably benign
IGL01104:Chd6 APN 2 160,803,847 (GRCm39) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,830,290 (GRCm39) splice site probably benign
IGL01717:Chd6 APN 2 160,807,179 (GRCm39) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,803,294 (GRCm39) missense probably benign 0.00
IGL01814:Chd6 APN 2 160,901,849 (GRCm39) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,825,598 (GRCm39) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,819,432 (GRCm39) missense probably benign
IGL02158:Chd6 APN 2 160,868,212 (GRCm39) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,807,595 (GRCm39) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,826,372 (GRCm39) splice site probably benign
IGL02522:Chd6 APN 2 160,807,716 (GRCm39) missense probably benign 0.30
IGL02626:Chd6 APN 2 160,881,270 (GRCm39) splice site probably benign
IGL02727:Chd6 APN 2 160,811,383 (GRCm39) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,807,618 (GRCm39) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,802,183 (GRCm39) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,826,552 (GRCm39) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,832,221 (GRCm39) missense probably damaging 1.00
IGL02850:Chd6 APN 2 160,861,536 (GRCm39) nonsense probably null
IGL02979:Chd6 APN 2 160,808,090 (GRCm39) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 160,894,304 (GRCm39) splice site probably benign
IGL03277:Chd6 APN 2 160,824,981 (GRCm39) missense probably null 1.00
IGL03346:Chd6 APN 2 160,802,282 (GRCm39) missense probably benign 0.00
IGL03357:Chd6 APN 2 160,859,936 (GRCm39) splice site probably benign
IGL03134:Chd6 UTSW 2 160,807,403 (GRCm39) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0212:Chd6 UTSW 2 160,894,767 (GRCm39) missense probably damaging 0.99
R0363:Chd6 UTSW 2 160,856,244 (GRCm39) missense probably damaging 1.00
R0399:Chd6 UTSW 2 160,894,608 (GRCm39) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,834,111 (GRCm39) missense probably damaging 0.99
R0771:Chd6 UTSW 2 160,861,500 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1184:Chd6 UTSW 2 160,872,722 (GRCm39) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,809,735 (GRCm39) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,825,023 (GRCm39) missense probably damaging 1.00
R1647:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1648:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,823,587 (GRCm39) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,808,559 (GRCm39) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,832,176 (GRCm39) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,809,920 (GRCm39) splice site probably benign
R1973:Chd6 UTSW 2 160,808,307 (GRCm39) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,825,673 (GRCm39) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2341:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2519:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R3025:Chd6 UTSW 2 160,808,472 (GRCm39) small deletion probably benign
R3426:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R3427:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,830,253 (GRCm39) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,803,211 (GRCm39) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,791,776 (GRCm39) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,807,238 (GRCm39) missense probably benign
R4458:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 160,856,114 (GRCm39) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,811,412 (GRCm39) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,812,103 (GRCm39) missense probably benign
R4765:Chd6 UTSW 2 160,808,164 (GRCm39) nonsense probably null
R4779:Chd6 UTSW 2 160,791,477 (GRCm39) missense probably damaging 1.00
R4877:Chd6 UTSW 2 160,871,219 (GRCm39) splice site probably benign
R5068:Chd6 UTSW 2 160,808,289 (GRCm39) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,791,873 (GRCm39) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,811,283 (GRCm39) missense probably benign
R5405:Chd6 UTSW 2 160,807,310 (GRCm39) missense probably benign
R5598:Chd6 UTSW 2 160,856,032 (GRCm39) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,807,185 (GRCm39) missense probably benign
R5697:Chd6 UTSW 2 160,859,971 (GRCm39) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,791,798 (GRCm39) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,825,682 (GRCm39) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,798,999 (GRCm39) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,798,998 (GRCm39) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,807,747 (GRCm39) missense probably benign 0.00
R6025:Chd6 UTSW 2 160,807,502 (GRCm39) missense probably benign
R6104:Chd6 UTSW 2 160,856,052 (GRCm39) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,791,968 (GRCm39) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,821,407 (GRCm39) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,807,418 (GRCm39) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 160,854,987 (GRCm39) missense probably damaging 1.00
R6784:Chd6 UTSW 2 160,808,174 (GRCm39) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,802,279 (GRCm39) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,807,650 (GRCm39) missense probably benign
R6895:Chd6 UTSW 2 160,830,260 (GRCm39) missense probably damaging 1.00
R6925:Chd6 UTSW 2 160,855,047 (GRCm39) missense probably damaging 0.98
R7061:Chd6 UTSW 2 160,867,885 (GRCm39) nonsense probably null
R7064:Chd6 UTSW 2 160,791,983 (GRCm39) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,803,199 (GRCm39) nonsense probably null
R7287:Chd6 UTSW 2 160,850,312 (GRCm39) missense probably benign 0.07
R7431:Chd6 UTSW 2 160,868,248 (GRCm39) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,791,923 (GRCm39) missense probably damaging 1.00
R7509:Chd6 UTSW 2 160,855,074 (GRCm39) missense probably damaging 1.00
R7699:Chd6 UTSW 2 160,867,863 (GRCm39) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,808,539 (GRCm39) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,812,095 (GRCm39) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,799,002 (GRCm39) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8388:Chd6 UTSW 2 160,861,571 (GRCm39) missense probably damaging 1.00
R8865:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8867:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,823,543 (GRCm39) missense probably damaging 1.00
R9091:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9270:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9310:Chd6 UTSW 2 160,881,181 (GRCm39) missense probably damaging 1.00
R9367:Chd6 UTSW 2 160,871,784 (GRCm39) missense possibly damaging 0.83
R9438:Chd6 UTSW 2 160,799,078 (GRCm39) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,802,259 (GRCm39) missense probably benign
Z1088:Chd6 UTSW 2 160,808,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCTGTACCTTTTGGG -3'
(R):5'- CATCGTCATGAGGGAAAGGC -3'

Sequencing Primer
(F):5'- GACAGAGGCATTTTTATAGCTCAGC -3'
(R):5'- TTGAACTCAAGGCCAGCTTG -3'
Posted On 2014-12-29