Incidental Mutation 'R2925:Zbtb11'
ID255728
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Namezinc finger and BTB domain containing 11
SynonymsZNF-U69274, 9230110G02Rik
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55973883-56008913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55974084 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 8 (R8Q)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023269] [ENSMUST00000050248]
Predicted Effect probably benign
Transcript: ENSMUST00000023269
SMART Domains Protein: ENSMUSP00000023269
Gene: ENSMUSG00000098274

DomainStartEndE-ValueType
TRASH 6 44 9.53e-6 SMART
low complexity region 102 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050248
AA Change: R8Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: R8Q

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122365
SMART Domains Protein: ENSMUSP00000114135
Gene: ENSMUSG00000022601

DomainStartEndE-ValueType
TRASH 6 44 9.53e-6 SMART
coiled coil region 102 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186480
Meta Mutation Damage Score 0.0655 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
AI314180 T A 4: 58,833,928 K851* probably null Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Ap4b1 A G 3: 103,820,681 E337G probably damaging Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
Olfr460 T A 6: 40,571,408 S7R probably benign Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 56000602 nonsense probably null
IGL01107:Zbtb11 APN 16 56006007 missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55990931 missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55990343 missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55980610 missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55998160 missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55991008 missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55982350 missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55974189 missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 56000675 missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55998193 nonsense probably null
R0987:Zbtb11 UTSW 16 55990708 missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55990560 nonsense probably null
R1437:Zbtb11 UTSW 16 55991620 critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55990815 missense probably benign
R1658:Zbtb11 UTSW 16 55974225 missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55990682 missense probably benign
R2048:Zbtb11 UTSW 16 55998009 missense probably damaging 1.00
R4072:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 56006065 missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 56000713 missense probably benign 0.02
R5757:Zbtb11 UTSW 16 56007029 missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55998073 missense probably benign 0.00
R6313:Zbtb11 UTSW 16 55990491 missense probably benign 0.03
R6461:Zbtb11 UTSW 16 56006871 missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 56006252 missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55990502 missense probably benign 0.03
R7194:Zbtb11 UTSW 16 56007188 missense probably damaging 1.00
R7424:Zbtb11 UTSW 16 55990487 missense probably benign 0.01
R8022:Zbtb11 UTSW 16 56006020 missense probably damaging 0.99
R8436:Zbtb11 UTSW 16 56000659 nonsense probably null
R8532:Zbtb11 UTSW 16 55990889 missense probably benign 0.03
R8806:Zbtb11 UTSW 16 55982274 missense probably damaging 1.00
RF014:Zbtb11 UTSW 16 55980597 missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55991502 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTTTGTCAGTCGCCAGC -3'
(R):5'- AGTAGGTCTTGGACAGGTCG -3'

Sequencing Primer
(F):5'- TGCCGAAGTGCAGTTCC -3'
(R):5'- TCTTGGACAGGTCGTGCCAG -3'
Posted On2014-12-29