Incidental Mutation 'R6313:Zbtb11'
ID 510551
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Name zinc finger and BTB domain containing 11
Synonyms ZNF-U69274, 9230110G02Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R6313 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 55973883-56008913 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55990491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 337 (N337K)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
AlphaFold G5E8B9
Predicted Effect probably benign
Transcript: ENSMUST00000050248
AA Change: N337K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: N337K

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183440
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S possibly damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 56000602 nonsense probably null
IGL01107:Zbtb11 APN 16 56006007 missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55990931 missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55990343 missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55980610 missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55998160 missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55991008 missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55982350 missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55974189 missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 56000675 missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55998193 nonsense probably null
R0987:Zbtb11 UTSW 16 55990708 missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55990560 nonsense probably null
R1437:Zbtb11 UTSW 16 55991620 critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55990815 missense probably benign
R1658:Zbtb11 UTSW 16 55974225 missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55990682 missense probably benign
R2048:Zbtb11 UTSW 16 55998009 missense probably damaging 1.00
R2925:Zbtb11 UTSW 16 55974084 missense probably benign 0.00
R4072:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 56006065 missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 56000713 missense probably benign 0.02
R5757:Zbtb11 UTSW 16 56007029 missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55998073 missense probably benign 0.00
R6461:Zbtb11 UTSW 16 56006871 missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 56006252 missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55990502 missense probably benign 0.03
R7194:Zbtb11 UTSW 16 56007188 missense probably damaging 1.00
R7424:Zbtb11 UTSW 16 55990487 missense probably benign 0.01
R8022:Zbtb11 UTSW 16 56006020 missense probably damaging 0.99
R8436:Zbtb11 UTSW 16 56000659 nonsense probably null
R8532:Zbtb11 UTSW 16 55990889 missense probably benign 0.03
R8806:Zbtb11 UTSW 16 55982274 missense probably damaging 1.00
R9033:Zbtb11 UTSW 16 55998129 missense probably benign
R9673:Zbtb11 UTSW 16 56006973 missense probably damaging 1.00
RF014:Zbtb11 UTSW 16 55980597 missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55991502 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAAGCAAGCTTCCTTCCTTTG -3'
(R):5'- ACACACTAGCTTCAGCCTCTG -3'

Sequencing Primer
(F):5'- GCTGGAATTTGCCTATACTTCTG -3'
(R):5'- TTCAGCCTCTGGAGAAGCCTG -3'
Posted On 2018-04-02