Incidental Mutation 'R6313:Zbtb11'
ID 510551
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Name zinc finger and BTB domain containing 11
Synonyms 9230110G02Rik, ZNF-U69274
MMRRC Submission 044470-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R6313 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 55794246-55829276 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55810854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 337 (N337K)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
AlphaFold G5E8B9
Predicted Effect probably benign
Transcript: ENSMUST00000050248
AA Change: N337K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: N337K

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183440
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,126,344 (GRCm39) F1167L probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Acaca C T 11: 84,183,755 (GRCm39) T32I probably benign Het
Adam6a A T 12: 113,508,670 (GRCm39) N348Y possibly damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgef38 T C 3: 132,940,469 (GRCm39) D39G possibly damaging Het
Arid5b T C 10: 67,933,412 (GRCm39) D587G possibly damaging Het
Brwd1 A G 16: 95,809,141 (GRCm39) V1963A probably benign Het
Ccdc136 T A 6: 29,410,204 (GRCm39) L34Q probably damaging Het
Cdh2 T C 18: 16,907,579 (GRCm39) Q53R probably benign Het
Celsr2 G A 3: 108,308,530 (GRCm39) S1799L probably damaging Het
Cenpe A G 3: 134,935,936 (GRCm39) E457G probably benign Het
Cmtm1 A T 8: 105,031,795 (GRCm39) M283K possibly damaging Het
Dcdc5 T C 2: 106,198,516 (GRCm39) noncoding transcript Het
Decr1 T A 4: 15,924,261 (GRCm39) M220L probably benign Het
Dgkg T G 16: 22,338,311 (GRCm39) D592A probably damaging Het
Dkkl1 T C 7: 44,860,862 (GRCm39) Q39R probably benign Het
Dyrk1a T A 16: 94,460,373 (GRCm39) C10S possibly damaging Het
Efcab2 A T 1: 178,308,936 (GRCm39) E146D probably benign Het
Efhc1 T C 1: 21,049,652 (GRCm39) V504A possibly damaging Het
Ermard T G 17: 15,273,467 (GRCm39) probably null Het
Espl1 T C 15: 102,224,247 (GRCm39) V1266A probably benign Het
Fbxw22 A C 9: 109,232,465 (GRCm39) V40G probably damaging Het
Gm3629 A T 14: 17,834,409 (GRCm39) I194N possibly damaging Het
Gnai2 C T 9: 107,497,296 (GRCm39) V33M possibly damaging Het
H2-DMb1 T C 17: 34,376,506 (GRCm39) probably null Het
Hc T C 2: 34,879,851 (GRCm39) probably null Het
Iars1 T C 13: 49,861,921 (GRCm39) S491P probably damaging Het
Knl1 T A 2: 118,899,799 (GRCm39) L500H probably damaging Het
Lamb1 A T 12: 31,319,146 (GRCm39) T102S probably damaging Het
Lrrc7 A G 3: 157,866,373 (GRCm39) S1123P probably damaging Het
Mettl5 C A 2: 69,702,071 (GRCm39) probably null Het
Mmp11 A G 10: 75,759,818 (GRCm39) *4R probably null Het
Myom1 A T 17: 71,389,483 (GRCm39) D911V probably benign Het
Nid1 A G 13: 13,638,367 (GRCm39) T96A probably benign Het
Nlrp4e G T 7: 23,052,597 (GRCm39) V839L probably benign Het
Notch3 A T 17: 32,370,128 (GRCm39) probably null Het
Or8k35 T C 2: 86,424,411 (GRCm39) T254A possibly damaging Het
Pcdh8 T C 14: 80,005,091 (GRCm39) H978R probably benign Het
Pde8b A T 13: 95,178,508 (GRCm39) C537* probably null Het
Polr1b T C 2: 128,967,366 (GRCm39) F920L probably damaging Het
Polr2f A G 15: 79,035,573 (GRCm39) T87A probably damaging Het
Pon2 T A 6: 5,272,421 (GRCm39) H133L probably damaging Het
Pou2af2 C T 9: 51,201,481 (GRCm39) D192N probably damaging Het
Ptk2b T A 14: 66,416,280 (GRCm39) E205V probably damaging Het
Rb1cc1 T A 1: 6,314,357 (GRCm39) M343K probably benign Het
Rlf G A 4: 121,005,807 (GRCm39) R1058W probably damaging Het
S100z T A 13: 95,615,082 (GRCm39) K28* probably null Het
Scarf1 T A 11: 75,411,141 (GRCm39) N273K probably benign Het
Setd2 A G 9: 110,385,434 (GRCm39) I136M unknown Het
Sfrp2 A G 3: 83,674,291 (GRCm39) D148G probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Slc2a9 T G 5: 38,610,464 (GRCm39) I112L probably benign Het
Smc5 A T 19: 23,186,312 (GRCm39) Y972* probably null Het
Sntg1 T C 1: 8,515,248 (GRCm39) probably null Het
Spata31h1 T C 10: 82,129,470 (GRCm39) N1180S probably benign Het
Stag1 A G 9: 100,639,786 (GRCm39) D114G probably damaging Het
Suclg1 T C 6: 73,233,192 (GRCm39) S46P probably damaging Het
Synj1 C T 16: 90,743,703 (GRCm39) A1186T probably benign Het
Tas2r124 A G 6: 132,732,410 (GRCm39) T240A probably benign Het
Tax1bp1 T C 6: 52,721,341 (GRCm39) probably null Het
Tchh C A 3: 93,355,158 (GRCm39) Q1533K unknown Het
Tmprss15 T C 16: 78,759,058 (GRCm39) T887A probably benign Het
Ttn T C 2: 76,536,937 (GRCm39) I34963V probably benign Het
Unc79 G A 12: 103,078,878 (GRCm39) G1485D probably damaging Het
Usp9y G T Y: 1,385,355 (GRCm39) H633N probably benign Homo
Vmn2r99 A T 17: 19,602,867 (GRCm39) N541Y probably damaging Het
Zfp260 T A 7: 29,804,267 (GRCm39) C56S possibly damaging Het
Zfp457 C T 13: 67,440,746 (GRCm39) E610K probably damaging Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 55,820,965 (GRCm39) nonsense probably null
IGL01107:Zbtb11 APN 16 55,826,370 (GRCm39) missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55,811,294 (GRCm39) missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55,810,706 (GRCm39) missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55,800,973 (GRCm39) missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55,818,523 (GRCm39) missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55,811,371 (GRCm39) missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55,802,713 (GRCm39) missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55,794,552 (GRCm39) missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 55,821,038 (GRCm39) missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55,818,556 (GRCm39) nonsense probably null
R0987:Zbtb11 UTSW 16 55,811,071 (GRCm39) missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55,810,923 (GRCm39) nonsense probably null
R1437:Zbtb11 UTSW 16 55,811,983 (GRCm39) critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55,811,178 (GRCm39) missense probably benign
R1658:Zbtb11 UTSW 16 55,794,588 (GRCm39) missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55,811,045 (GRCm39) missense probably benign
R2048:Zbtb11 UTSW 16 55,818,372 (GRCm39) missense probably damaging 1.00
R2925:Zbtb11 UTSW 16 55,794,447 (GRCm39) missense probably benign 0.00
R4072:Zbtb11 UTSW 16 55,818,427 (GRCm39) missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55,818,427 (GRCm39) missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55,818,427 (GRCm39) missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 55,826,428 (GRCm39) missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 55,821,076 (GRCm39) missense probably benign 0.02
R5757:Zbtb11 UTSW 16 55,827,392 (GRCm39) missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55,818,436 (GRCm39) missense probably benign 0.00
R6461:Zbtb11 UTSW 16 55,827,234 (GRCm39) missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 55,826,615 (GRCm39) missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55,810,865 (GRCm39) missense probably benign 0.03
R7194:Zbtb11 UTSW 16 55,827,551 (GRCm39) missense probably damaging 1.00
R7424:Zbtb11 UTSW 16 55,810,850 (GRCm39) missense probably benign 0.01
R8022:Zbtb11 UTSW 16 55,826,383 (GRCm39) missense probably damaging 0.99
R8436:Zbtb11 UTSW 16 55,821,022 (GRCm39) nonsense probably null
R8532:Zbtb11 UTSW 16 55,811,252 (GRCm39) missense probably benign 0.03
R8806:Zbtb11 UTSW 16 55,802,637 (GRCm39) missense probably damaging 1.00
R9033:Zbtb11 UTSW 16 55,818,492 (GRCm39) missense probably benign
R9673:Zbtb11 UTSW 16 55,827,336 (GRCm39) missense probably damaging 1.00
RF014:Zbtb11 UTSW 16 55,800,960 (GRCm39) missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55,811,865 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAAGCAAGCTTCCTTCCTTTG -3'
(R):5'- ACACACTAGCTTCAGCCTCTG -3'

Sequencing Primer
(F):5'- GCTGGAATTTGCCTATACTTCTG -3'
(R):5'- TTCAGCCTCTGGAGAAGCCTG -3'
Posted On 2018-04-02