Incidental Mutation 'R2960:Rfx3'
ID255897
Institutional Source Beutler Lab
Gene Symbol Rfx3
Ensembl Gene ENSMUSG00000040929
Gene Nameregulatory factor X, 3 (influences HLA class II expression)
SynonymsC230093O12Rik, MRFX3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2960 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location27761721-28011166 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 27900811 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 29 (Q29*)
Ref Sequence ENSEMBL: ENSMUSP00000133461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046898] [ENSMUST00000165566] [ENSMUST00000172907] [ENSMUST00000173863] [ENSMUST00000174420] [ENSMUST00000174850]
Predicted Effect probably null
Transcript: ENSMUST00000046898
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000038760
Gene: ENSMUSG00000040929
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 6.3e-58 PFAM
Pfam:RFX_DNA_binding 150 235 6.9e-41 PFAM
low complexity region 274 283 N/A INTRINSIC
internal_repeat_1 326 414 1.39e-5 PROSPERO
internal_repeat_1 439 527 1.39e-5 PROSPERO
low complexity region 649 664 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165566
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000126313
Gene: ENSMUSG00000040929
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 138 9.7e-38 PFAM
Pfam:RFX_DNA_binding 181 258 6.2e-36 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172907
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000134141
Gene: ENSMUSG00000040929
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173161
Predicted Effect probably null
Transcript: ENSMUST00000173863
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000133367
Gene: ENSMUSG00000040929
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 3.3e-58 PFAM
Pfam:RFX_DNA_binding 175 246 3.7e-24 PFAM
low complexity region 285 294 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174420
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000134700
Gene: ENSMUSG00000040929
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 70 3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174850
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000133461
Gene: ENSMUSG00000040929
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 140 9.4e-58 PFAM
Pfam:RFX_DNA_binding 175 260 5.2e-41 PFAM
low complexity region 299 308 N/A INTRINSIC
internal_repeat_1 351 439 1.82e-5 PROSPERO
internal_repeat_1 464 552 1.82e-5 PROSPERO
low complexity region 674 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice display embryonic and perinatal lethality, impaired development of cilia on the embryonic node, abnormal left-right patterning, meso- and dextrocardia, and situs inversus in surviving adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Rfx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Rfx3 APN 19 27806186 critical splice donor site probably null
IGL00588:Rfx3 APN 19 27826076 nonsense probably null
IGL01408:Rfx3 APN 19 27768650 missense probably benign 0.04
IGL01937:Rfx3 APN 19 27830729 missense probably damaging 1.00
IGL02668:Rfx3 APN 19 27815614 splice site probably benign
IGL02679:Rfx3 APN 19 27849737 missense possibly damaging 0.95
R0267:Rfx3 UTSW 19 27793788 missense probably benign 0.00
R0336:Rfx3 UTSW 19 27806262 missense probably benign 0.00
R0838:Rfx3 UTSW 19 27849967 missense possibly damaging 0.92
R0967:Rfx3 UTSW 19 27806351 splice site probably benign
R1102:Rfx3 UTSW 19 27867600 missense possibly damaging 0.51
R1507:Rfx3 UTSW 19 27768513 missense probably benign 0.00
R2172:Rfx3 UTSW 19 27815494 nonsense probably null
R2844:Rfx3 UTSW 19 27806786 splice site probably benign
R4291:Rfx3 UTSW 19 27800232 missense probably damaging 1.00
R4952:Rfx3 UTSW 19 27830672 missense probably damaging 1.00
R5198:Rfx3 UTSW 19 27830776 missense probably damaging 1.00
R5451:Rfx3 UTSW 19 27849959 missense probably damaging 1.00
R5590:Rfx3 UTSW 19 27802380 critical splice donor site probably null
R5641:Rfx3 UTSW 19 27793608 splice site probably null
R5663:Rfx3 UTSW 19 27793617 missense probably damaging 1.00
R5899:Rfx3 UTSW 19 27830765 missense probably damaging 1.00
R6049:Rfx3 UTSW 19 27802395 missense probably damaging 0.99
R6368:Rfx3 UTSW 19 27768609 missense possibly damaging 0.92
R7131:Rfx3 UTSW 19 27768628 nonsense probably null
R7273:Rfx3 UTSW 19 27802458 missense probably damaging 1.00
R7593:Rfx3 UTSW 19 27849739 missense probably benign 0.00
Z1088:Rfx3 UTSW 19 27837450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTCTACAGCCCAGCAAGG -3'
(R):5'- CCTCGTAATAGGATTTAAGAACTGC -3'

Sequencing Primer
(F):5'- TAACCAAGAGATGTCTGCTATCC -3'
(R):5'- GAACTGCAGTGACACTTATCATGC -3'
Posted On2014-12-29