Incidental Mutation 'R0331:Itga10'
ID26034
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 038540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0331 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96652483 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably damaging
Transcript: ENSMUST00000029744
AA Change: Y485H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: Y485H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119365
AA Change: Y485H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: Y485H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127607
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.6994 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,229,392 T79S probably benign Het
Abtb1 T C 6: 88,840,702 probably benign Het
Acot12 G A 13: 91,760,064 probably null Het
Adamts4 T A 1: 171,250,972 S54T probably benign Het
Adgrl4 T C 3: 151,497,940 S96P probably benign Het
Aip G T 19: 4,118,247 T40K probably damaging Het
Anapc4 A G 5: 52,855,642 probably benign Het
Asz1 A G 6: 18,103,619 probably benign Het
Atf7ip A G 6: 136,561,163 T465A possibly damaging Het
Atp11a C T 8: 12,816,953 Q127* probably null Het
Axin1 A G 17: 26,143,107 R142G probably damaging Het
B230359F08Rik A G 14: 53,795,748 N38S probably benign Het
Bcat1 T A 6: 145,047,314 E86V probably benign Het
Brd4 G A 17: 32,202,515 P749L probably benign Het
C1ra G A 6: 124,519,435 probably null Het
Capza2 A T 6: 17,665,103 N237I probably benign Het
Cd2ap A T 17: 42,805,301 V556E probably benign Het
Cfap65 G A 1: 74,929,301 P124L probably damaging Het
Cfap65 G T 1: 74,929,302 P124T probably damaging Het
Cftr T C 6: 18,235,226 V488A possibly damaging Het
Ckmt1 A T 2: 121,362,856 probably null Het
Cmya5 T G 13: 93,144,403 E35A possibly damaging Het
Col7a1 A G 9: 108,967,502 probably benign Het
Crmp1 C T 5: 37,265,313 L155F possibly damaging Het
Cyp2d10 T A 15: 82,407,026 T33S probably benign Het
Dhdh T C 7: 45,488,120 K48E probably benign Het
Dlst T C 12: 85,118,812 V103A probably damaging Het
Dohh C T 10: 81,387,812 T233I probably benign Het
Dvl2 C A 11: 70,006,217 probably benign Het
Eipr1 C T 12: 28,864,704 Q286* probably null Het
Enpp6 C A 8: 47,082,449 T343K probably damaging Het
Fbxw11 T A 11: 32,711,895 F112I probably damaging Het
Gdpd4 T A 7: 97,973,008 N231K probably benign Het
Gm6370 A T 5: 146,493,766 T254S probably benign Het
Hapln4 G T 8: 70,084,509 Q31H probably damaging Het
Hic1 T A 11: 75,165,490 T858S possibly damaging Het
Isg20l2 T C 3: 87,931,785 L101P probably damaging Het
Itgal T A 7: 127,306,681 probably null Het
Itln1 T C 1: 171,531,549 N62S probably damaging Het
Kdm4b T C 17: 56,386,289 probably benign Het
Lct T C 1: 128,298,742 probably benign Het
Lman2 A T 13: 55,353,016 H123Q probably damaging Het
Lztr1 T A 16: 17,524,237 probably benign Het
Myo3b G T 2: 70,095,261 G24V probably damaging Het
Nacad T A 11: 6,599,441 Q1250L possibly damaging Het
Ncor2 A T 5: 125,084,917 M431K unknown Het
Nek9 T A 12: 85,327,375 probably benign Het
Neu1 C A 17: 34,934,170 N255K possibly damaging Het
Nf2 T A 11: 4,794,914 T75S probably benign Het
Nipal4 T A 11: 46,150,213 D385V probably damaging Het
Olah T A 2: 3,342,474 N245I probably damaging Het
Olfr474 G T 7: 107,954,870 L76F probably benign Het
Pag1 T A 3: 9,701,970 T90S probably benign Het
Pald1 A G 10: 61,340,929 probably null Het
Parva A G 7: 112,544,798 M98V probably benign Het
Paxbp1 T A 16: 91,037,367 D177V possibly damaging Het
Paxip1 A G 5: 27,765,232 I587T probably damaging Het
Pclo T C 5: 14,680,376 probably benign Het
Pdgfra T A 5: 75,195,052 D1074E probably damaging Het
Pef1 A T 4: 130,127,448 D265V probably damaging Het
Plekhh2 G A 17: 84,586,366 E870K possibly damaging Het
Plscr4 G A 9: 92,482,642 G40D probably damaging Het
Psg18 A G 7: 18,353,308 Y142H probably benign Het
Ptchd3 A T 11: 121,842,191 M636L probably benign Het
Rab2a A G 4: 8,572,559 D51G probably benign Het
Rnf139 T A 15: 58,899,906 D593E probably benign Het
Sept7 A G 9: 25,306,256 N422S probably benign Het
Shprh T C 10: 11,194,170 probably benign Het
Slc7a6os A G 8: 106,210,567 I87T probably damaging Het
Slc7a7 A G 14: 54,377,924 probably benign Het
Spc24 G T 9: 21,757,313 N129K possibly damaging Het
Strip2 C T 6: 29,926,560 T148I probably benign Het
Tmem150c A C 5: 100,086,273 probably null Het
Ttn G T 2: 76,811,020 Y11801* probably null Het
Usp37 A T 1: 74,454,064 L688* probably null Het
Usp38 T C 8: 80,995,840 I351V probably benign Het
Vav2 T A 2: 27,296,175 M223L probably benign Het
Wdr36 A G 18: 32,852,915 I557M possibly damaging Het
Wwc2 A T 8: 47,880,204 M259K probably benign Het
Znfx1 G A 2: 167,046,978 S770L probably benign Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 splice site probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCTTATGCCTTCAGGAAACCCTC -3'
(R):5'- AAGCTCTCAAATATGTGTGCCTCCC -3'

Sequencing Primer
(F):5'- cccccCAGGGACTGGAC -3'
(R):5'- AAATATGTGTGCCTCCCTCTTC -3'
Posted On2013-04-16