Incidental Mutation 'R2886:Kcnq5'
ID261034
Institutional Source Beutler Lab
Gene Symbol Kcnq5
Ensembl Gene ENSMUSG00000028033
Gene Namepotassium voltage-gated channel, subfamily Q, member 5
Synonyms9230107O05Rik, D1Mgi1
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R2886 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location21398403-21961942 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 21469547 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 382 (Y382*)
Ref Sequence ENSEMBL: ENSMUSP00000134076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029667] [ENSMUST00000115300] [ENSMUST00000173058] [ENSMUST00000173404] [ENSMUST00000174183]
Predicted Effect probably null
Transcript: ENSMUST00000029667
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000029667
Gene: ENSMUSG00000028033
AA Change: Y382*

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 1.7e-26 PFAM
Pfam:Ion_trans_2 272 352 5.3e-15 PFAM
Pfam:KCNQ_channel 446 648 3.6e-95 PFAM
low complexity region 848 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115299
Predicted Effect probably null
Transcript: ENSMUST00000115300
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000110955
Gene: ENSMUSG00000028033
AA Change: Y382*

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
Pfam:Ion_trans 126 359 4.1e-28 PFAM
Pfam:Ion_trans_2 272 352 3.3e-16 PFAM
Pfam:KCNQ_channel 467 661 1.8e-98 PFAM
low complexity region 867 877 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173058
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000134166
Gene: ENSMUSG00000028033
AA Change: Y382*

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2e-26 PFAM
Pfam:Ion_trans_2 272 352 3.1e-15 PFAM
Pfam:KCNQ_channel 405 538 8e-64 PFAM
low complexity region 738 748 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173404
AA Change: Y382*
SMART Domains Protein: ENSMUSP00000134076
Gene: ENSMUSG00000028033
AA Change: Y382*

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Ion_trans 163 347 2.4e-26 PFAM
Pfam:Ion_trans_2 272 352 3.6e-15 PFAM
Pfam:KCNQ_channel 437 639 2e-95 PFAM
low complexity region 839 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174183
SMART Domains Protein: ENSMUSP00000134389
Gene: ENSMUSG00000028033

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 52 82 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a dominant negative knock-in mutation in this gene exhibit partial prenatal lethality and abnormal afterhyperpolarization in the in the CA3 area of hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Cables1 A G 18: 11,939,732 D448G possibly damaging Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Selenon T C 4: 134,543,069 D324G probably null Het
Serpinh1 T C 7: 99,349,021 Y134C probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc27a5 T A 7: 12,989,560 probably benign Het
Slc5a4b C T 10: 76,075,073 V310M probably damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Kcnq5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Kcnq5 APN 1 21505763 missense probably damaging 1.00
IGL01603:Kcnq5 APN 1 21505340 missense possibly damaging 0.94
IGL02326:Kcnq5 APN 1 21402592 missense probably benign 0.17
IGL02624:Kcnq5 APN 1 21402430 missense probably benign 0.27
IGL03151:Kcnq5 APN 1 21535069 missense probably damaging 1.00
IGL03367:Kcnq5 APN 1 21403065 missense probably damaging 1.00
PIT1430001:Kcnq5 UTSW 1 21535181 missense probably damaging 1.00
R0705:Kcnq5 UTSW 1 21535177 missense probably damaging 1.00
R0798:Kcnq5 UTSW 1 21961175 splice site probably null
R1263:Kcnq5 UTSW 1 21479378 missense probably damaging 1.00
R1445:Kcnq5 UTSW 1 21405024 missense probably benign 0.01
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1465:Kcnq5 UTSW 1 21469468 critical splice donor site probably null
R1497:Kcnq5 UTSW 1 21402386 missense possibly damaging 0.82
R1515:Kcnq5 UTSW 1 21402681 missense probably benign 0.01
R1610:Kcnq5 UTSW 1 21457461 missense probably damaging 1.00
R1835:Kcnq5 UTSW 1 21466387 missense probably benign 0.04
R1999:Kcnq5 UTSW 1 21402204 missense probably null 0.18
R2060:Kcnq5 UTSW 1 21461597 missense probably benign 0.06
R2145:Kcnq5 UTSW 1 21505349 missense probably damaging 0.96
R2314:Kcnq5 UTSW 1 21479371 splice site probably null
R2511:Kcnq5 UTSW 1 21505782 nonsense probably null
R2697:Kcnq5 UTSW 1 21479432 missense probably damaging 1.00
R2889:Kcnq5 UTSW 1 21402302 missense probably damaging 0.98
R4176:Kcnq5 UTSW 1 21535168 missense probably damaging 1.00
R4609:Kcnq5 UTSW 1 21405068 splice site probably null
R4720:Kcnq5 UTSW 1 21403050 missense probably damaging 0.96
R4904:Kcnq5 UTSW 1 21424100 missense probably damaging 0.98
R5184:Kcnq5 UTSW 1 21402487 missense probably damaging 1.00
R5268:Kcnq5 UTSW 1 21505725 missense probably damaging 1.00
R5373:Kcnq5 UTSW 1 21961571 missense unknown
R5397:Kcnq5 UTSW 1 21405856 missense probably damaging 1.00
R5473:Kcnq5 UTSW 1 21457402 critical splice donor site probably null
R5490:Kcnq5 UTSW 1 21479468 missense probably damaging 1.00
R5946:Kcnq5 UTSW 1 21505707 missense probably damaging 1.00
R6941:Kcnq5 UTSW 1 21405844 missense probably damaging 1.00
R6962:Kcnq5 UTSW 1 21505793 missense probably damaging 1.00
R7201:Kcnq5 UTSW 1 21402875 missense possibly damaging 0.93
R7238:Kcnq5 UTSW 1 21402302 missense probably benign 0.39
R7375:Kcnq5 UTSW 1 21469486 missense possibly damaging 0.82
R7584:Kcnq5 UTSW 1 21402321 missense probably benign
R7780:Kcnq5 UTSW 1 21961331 missense probably benign 0.43
R8043:Kcnq5 UTSW 1 21479420 missense probably damaging 1.00
Z1088:Kcnq5 UTSW 1 21457529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCAGAGTGAGACTTCTG -3'
(R):5'- TGTCTCATTGTCGAACACTTTGG -3'

Sequencing Primer
(F):5'- GTGAGACTTCTGCACACATATGG -3'
(R):5'- GACGTGTGTAACTACCCACTG -3'
Posted On2015-01-23