Incidental Mutation 'R1065:Traf3ip1'
ID85949
Institutional Source Beutler Lab
Gene Symbol Traf3ip1
Ensembl Gene ENSMUSG00000034292
Gene NameTRAF3 interacting protein 1
SynonymsMIP-T3, 3930402D05Rik
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91494647-91529307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91500784 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 122 (D122E)
Ref Sequence ENSEMBL: ENSMUSP00000140151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047242] [ENSMUST00000189341]
Predicted Effect unknown
Transcript: ENSMUST00000047242
AA Change: D122E
SMART Domains Protein: ENSMUSP00000042391
Gene: ENSMUSG00000034292
AA Change: D122E

DomainStartEndE-ValueType
Pfam:MIP-T3 49 619 7e-207 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000189341
AA Change: D122E
SMART Domains Protein: ENSMUSP00000140151
Gene: ENSMUSG00000034292
AA Change: D122E

DomainStartEndE-ValueType
Pfam:MIP-T3 49 648 7.1e-203 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, cardiac edema, abnormal neural development, polydactyly, and microphthalmia associated with a lack of embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Traf3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Traf3ip1 APN 1 91518297 missense probably damaging 0.98
IGL01997:Traf3ip1 APN 1 91507570 critical splice donor site probably null
IGL02431:Traf3ip1 APN 1 91499635 missense unknown
IGL03106:Traf3ip1 APN 1 91522887 missense probably benign 0.26
R0538:Traf3ip1 UTSW 1 91499619 missense unknown
R1034:Traf3ip1 UTSW 1 91518319 splice site probably null
R1757:Traf3ip1 UTSW 1 91522857 missense probably damaging 1.00
R2360:Traf3ip1 UTSW 1 91499652 missense unknown
R2367:Traf3ip1 UTSW 1 91507520 missense possibly damaging 0.90
R3031:Traf3ip1 UTSW 1 91520100 missense probably damaging 1.00
R3752:Traf3ip1 UTSW 1 91500917 splice site probably benign
R3752:Traf3ip1 UTSW 1 91518297 missense probably damaging 0.98
R4690:Traf3ip1 UTSW 1 91520112 missense possibly damaging 0.90
R4747:Traf3ip1 UTSW 1 91527757 missense probably damaging 1.00
R5328:Traf3ip1 UTSW 1 91520069 missense probably damaging 1.00
R5540:Traf3ip1 UTSW 1 91501315 missense probably benign 0.07
R5910:Traf3ip1 UTSW 1 91527745 missense probably damaging 1.00
R6593:Traf3ip1 UTSW 1 91527695 missense possibly damaging 0.82
R6836:Traf3ip1 UTSW 1 91521000 missense probably benign 0.17
R7249:Traf3ip1 UTSW 1 91527639 missense probably damaging 1.00
R7418:Traf3ip1 UTSW 1 91507736 splice site probably null
R7436:Traf3ip1 UTSW 1 91511388 missense probably benign 0.02
R7597:Traf3ip1 UTSW 1 91511445 missense probably damaging 0.97
R7751:Traf3ip1 UTSW 1 91494757 start gained probably benign
R8031:Traf3ip1 UTSW 1 91501419 missense probably damaging 1.00
R8179:Traf3ip1 UTSW 1 91500801 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCACACTAACATTTGGAGAGAGGG -3'
(R):5'- GTTACACAGACTTGCCGTGTCAGAG -3'

Sequencing Primer
(F):5'- CAGTGTCATTGGTGCTCAAAC -3'
(R):5'- TGTCAGAGACGTGCATCCTAC -3'
Posted On2013-11-18