Incidental Mutation 'R3052:B430306N03Rik'
ID265010
Institutional Source Beutler Lab
Gene Symbol B430306N03Rik
Ensembl Gene ENSMUSG00000043740
Gene NameRIKEN cDNA B430306N03 gene
Synonyms
MMRRC Submission 040561-MU
Accession Numbers

Genbank: NM_177083.4; Ensembl: ENSMUST00000049614

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48316141-48327024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48316910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 80 (S80P)
Ref Sequence ENSEMBL: ENSMUSP00000054890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049614] [ENSMUST00000125174] [ENSMUST00000129825] [ENSMUST00000170941]
Predicted Effect probably damaging
Transcript: ENSMUST00000049614
AA Change: S80P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054890
Gene: ENSMUSG00000043740
AA Change: S80P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 2.96e-6 SMART
transmembrane domain 155 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124205
Predicted Effect probably damaging
Transcript: ENSMUST00000125174
AA Change: S80P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120251
Gene: ENSMUSG00000043740
AA Change: S80P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 2.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129825
AA Change: S80P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122378
Gene: ENSMUSG00000043740
AA Change: S80P

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 2.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170941
SMART Domains Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 129 3.13e-5 SMART
low complexity region 181 199 N/A INTRINSIC
transmembrane domain 268 290 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in B430306N03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:B430306N03Rik APN 17 48321073 missense probably damaging 1.00
IGL02149:B430306N03Rik APN 17 48316992 missense probably benign 0.02
IGL02221:B430306N03Rik APN 17 48324195 utr 3 prime probably benign
IGL03112:B430306N03Rik APN 17 48316806 missense probably benign 0.06
IGL03223:B430306N03Rik APN 17 48316868 missense probably damaging 1.00
1mM(1):B430306N03Rik UTSW 17 48322403 splice site probably benign
R1917:B430306N03Rik UTSW 17 48324148 missense probably benign 0.44
R2086:B430306N03Rik UTSW 17 48316782 missense probably damaging 1.00
R3695:B430306N03Rik UTSW 17 48319166 missense possibly damaging 0.86
R6319:B430306N03Rik UTSW 17 48316743 missense probably damaging 1.00
R6453:B430306N03Rik UTSW 17 48316736 missense probably damaging 0.97
R6523:B430306N03Rik UTSW 17 48319165 missense possibly damaging 0.53
R7140:B430306N03Rik UTSW 17 48322455 nonsense probably null
R7905:B430306N03Rik UTSW 17 48316960 missense probably benign 0.10
R7988:B430306N03Rik UTSW 17 48316960 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AACATTTATTCCCAGGCTCCTG -3'
(R):5'- AGGAAGCTGTTTCTTGAGTCC -3'

Sequencing Primer
(F):5'- TGGACACAGAAACCAGAGTTACTTCG -3'
(R):5'- ACTCTGGAGCCTTGCAACTCAG -3'
Posted On2015-02-05