Incidental Mutation 'K7894:Prmt3'
ID26519
Institutional Source Beutler Lab
Gene Symbol Prmt3
Ensembl Gene ENSMUSG00000030505
Gene Nameprotein arginine N-methyltransferase 3
SynonymsHrmt1l3, 2010005E20Rik, 2410018A17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #K7894 () of strain 468
Quality Score222
Status Validated (trace)
Chromosome7
Chromosomal Location49778346-49858265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49826711 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000032715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032715] [ENSMUST00000147401]
Predicted Effect probably damaging
Transcript: ENSMUST00000032715
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032715
Gene: ENSMUSG00000030505
AA Change: Y356C

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
ZnF_C2H2 46 69 2.41e1 SMART
coiled coil region 156 191 N/A INTRINSIC
Pfam:PRMT5 212 508 5.7e-8 PFAM
Pfam:Methyltransf_9 220 392 9.3e-9 PFAM
Pfam:MTS 242 326 5.4e-7 PFAM
Pfam:PrmA 245 343 4.3e-13 PFAM
Pfam:Methyltransf_31 250 407 8.8e-11 PFAM
Pfam:Methyltransf_18 252 360 2.5e-11 PFAM
Pfam:Methyltransf_11 257 356 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130907
SMART Domains Protein: ENSMUSP00000114676
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
PDB:1F3L|A 1 135 3e-93 PDB
SCOP:d1f3la_ 2 135 2e-17 SMART
Blast:FBG 73 118 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147401
SMART Domains Protein: ENSMUSP00000115155
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
PDB:1WIR|A 38 64 1e-13 PDB
Blast:ZnF_C2H2 46 64 1e-5 BLAST
Meta Mutation Damage Score 0.7563 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts on 40S ribosomal protein S2 (rpS2), which is its major in-vivo substrate, and is involved in the proper maturation of the 80S ribosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit a reduced embryonic size but survive birth and attain a normal size in adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Acsl4 C T X: 142,328,060 V632I probably benign Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Olfr652 A G 7: 104,564,532 T104A probably benign Het
Pde8a C A 7: 81,306,765 P304H probably damaging Het
Rsph10b A G 5: 143,944,520 D151G probably damaging Het
Spryd3 A G 15: 102,118,141 V365A probably benign Het
Vmn1r58 T C 7: 5,410,703 N176S probably benign Het
Other mutations in Prmt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Prmt3 APN 7 49792009 missense probably damaging 1.00
IGL01444:Prmt3 APN 7 49780372 missense probably benign 0.00
IGL01688:Prmt3 APN 7 49848732 splice site probably null
IGL02041:Prmt3 APN 7 49828963 missense possibly damaging 0.91
IGL02304:Prmt3 APN 7 49826737 missense probably benign 0.44
IGL02389:Prmt3 APN 7 49848758 nonsense probably null
IGL02879:Prmt3 APN 7 49818063 missense probably benign 0.39
R0616:Prmt3 UTSW 7 49787328 missense probably damaging 1.00
R0667:Prmt3 UTSW 7 49791995 missense probably damaging 1.00
R1170:Prmt3 UTSW 7 49848547 critical splice donor site probably null
R1343:Prmt3 UTSW 7 49818108 missense probably benign 0.19
R1562:Prmt3 UTSW 7 49826854 missense probably benign 0.00
R1614:Prmt3 UTSW 7 49826719 missense possibly damaging 0.95
R1777:Prmt3 UTSW 7 49798346 missense possibly damaging 0.92
R3113:Prmt3 UTSW 7 49782012 missense probably damaging 1.00
R4170:Prmt3 UTSW 7 49826776 missense probably benign 0.01
R4403:Prmt3 UTSW 7 49780357 missense probably damaging 1.00
R4463:Prmt3 UTSW 7 49818089 missense probably damaging 1.00
R4962:Prmt3 UTSW 7 49826809 missense probably benign 0.00
R5144:Prmt3 UTSW 7 49786135 missense possibly damaging 0.48
R5364:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5586:Prmt3 UTSW 7 49826751 missense probably damaging 1.00
R5624:Prmt3 UTSW 7 49780334 missense probably damaging 0.97
R5820:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5992:Prmt3 UTSW 7 49828947 missense probably benign 0.00
R6931:Prmt3 UTSW 7 49829016 missense probably benign 0.00
R7117:Prmt3 UTSW 7 49818095 missense probably benign 0.00
X0064:Prmt3 UTSW 7 49781974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTATTGCTGGGATGCTGACTTTAC -3'
(R):5'- GGCAATGCTCACACACCTACCTTG -3'

Sequencing Primer
(F):5'- CTGGGATGCTGACTTTACTTTAC -3'
(R):5'- GATATCACAAGGGTCTGAAATAAGAG -3'
Posted On2013-04-16