Mutagenetix > Incidental Mutations

Incidental Mutation 'K7894:Pde8a'

26520

Institutional Source

Beutler Lab

Gene Symbol

Pde8a

Ensembl Gene

ENSMUSG00000025584

Gene Name

phosphodiesterase 8A

Synonyms

Pde8

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

K7894 () of strain 468

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

81213596-81334533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81306765 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Histidine at position 304 (P304H)

Ref Sequence

ENSEMBL: ENSMUSP00000026672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026672]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026672
AA Change: P304H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: P304H

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
Blast:REC	79	194	2e-48	BLAST
PAS	211	277	2.18e-2	SMART
Blast:HDc	403	451	4e-11	BLAST
HDc	548	734	5.78e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128154

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130494

Meta Mutation Damage Score

0.9612

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 95.4%

Validation Efficiency

88% (22/25)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	CAA	3: 122,147,868		probably null	Het
Acsl4	C	T	X: 142,328,060	V632I	probably benign	Het
Adcy8	T	C	15: 64,822,234	H398R	probably benign	Het
Catsperg1	C	T	7: 29,197,154		probably benign	Het
Ccpg1	T	C	9: 73,001,877		probably null	Het
Clk4	G	T	11: 51,275,766		probably benign	Het
Ehbp1	C	T	11: 22,089,683		probably benign	Het
Eri2	T	C	7: 119,785,271	D669G	probably benign	Het
Nlrp9c	A	G	7: 26,384,898	S419P	possibly damaging	Het
Olfr652	A	G	7: 104,564,532	T104A	probably benign	Het
Prmt3	A	G	7: 49,826,711	Y356C	probably damaging	Het
Rsph10b	A	G	5: 143,944,520	D151G	probably damaging	Het
Spryd3	A	G	15: 102,118,141	V365A	probably benign	Het
Vmn1r58	T	C	7: 5,410,703	N176S	probably benign	Het

Other mutations in Pde8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Pde8a	APN	7	81306708	missense	possibly damaging	0.62
IGL00808:Pde8a	APN	7	81283014	critical splice donor site	probably null
IGL01134:Pde8a	APN	7	81319078	missense	possibly damaging	0.86
IGL01443:Pde8a	APN	7	81324181	missense	probably damaging	1.00
IGL02044:Pde8a	APN	7	81317449	critical splice donor site	probably null
IGL02269:Pde8a	APN	7	81308802	splice site	probably benign
IGL02528:Pde8a	APN	7	81293189	splice site	probably benign
IGL02738:Pde8a	APN	7	81326342	missense	probably damaging	1.00
IGL02937:Pde8a	APN	7	81295771	splice site	probably benign
IGL03072:Pde8a	APN	7	81308809	missense	probably damaging	1.00
cast_iron	UTSW	7	81282807	splice site	probably null
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0547:Pde8a	UTSW	7	81324130	missense	probably benign	0.00
R0552:Pde8a	UTSW	7	81317347	missense	probably benign	0.12
R1342:Pde8a	UTSW	7	81302294	critical splice donor site	probably null
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1502:Pde8a	UTSW	7	81292259	missense	probably damaging	1.00
R1568:Pde8a	UTSW	7	81292263	missense	probably damaging	1.00
R1768:Pde8a	UTSW	7	81300723	splice site	probably null
R2076:Pde8a	UTSW	7	81308945	missense	probably benign	0.11
R2165:Pde8a	UTSW	7	81295768	critical splice donor site	probably null
R2385:Pde8a	UTSW	7	81282992	missense	probably benign	0.45
R2518:Pde8a	UTSW	7	81317422	missense	probably benign	0.00
R4001:Pde8a	UTSW	7	81317356	missense	probably damaging	1.00
R4114:Pde8a	UTSW	7	81282807	splice site	probably null
R4115:Pde8a	UTSW	7	81282807	splice site	probably null
R4159:Pde8a	UTSW	7	81320659	missense	probably benign	0.13
R4299:Pde8a	UTSW	7	81328035	missense	probably benign
R4544:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4545:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4561:Pde8a	UTSW	7	81308820	nonsense	probably null
R4562:Pde8a	UTSW	7	81308820	nonsense	probably null
R4563:Pde8a	UTSW	7	81308820	nonsense	probably null
R4615:Pde8a	UTSW	7	81320737	missense	probably damaging	1.00
R4808:Pde8a	UTSW	7	81282931	missense	probably benign
R5396:Pde8a	UTSW	7	81333422	missense	probably damaging	1.00
R5840:Pde8a	UTSW	7	81213965	missense	probably benign
R5892:Pde8a	UTSW	7	81295691	missense	probably damaging	0.99
R6621:Pde8a	UTSW	7	81293130	critical splice acceptor site	probably null
R7067:Pde8a	UTSW	7	81317326	missense	probably benign	0.41
R7163:Pde8a	UTSW	7	81306708	missense	possibly damaging	0.62
R7483:Pde8a	UTSW	7	81282833	missense	probably benign	0.02
R7606:Pde8a	UTSW	7	81332967	missense	probably damaging	0.98
R7876:Pde8a	UTSW	7	81324071	missense	probably damaging	1.00
R8046:Pde8a	UTSW	7	81308839	missense	possibly damaging	0.90
R8046:Pde8a	UTSW	7	81317370	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TCTGAGTACACCTGCACCAAGTACC -3'
(R):5'- AGAGTAGTGGCTCTGGACTGCAAG -3'

Sequencing Primer
(F):5'- CTTCATGCAGCCAGTGAGAG -3'
(R):5'- ACTGCAAGTGGAAGGTCCTC -3'

Posted On

2013-04-16