Incidental Mutation 'K7894:Pde8a'
ID26520
Institutional Source Beutler Lab
Gene Symbol Pde8a
Ensembl Gene ENSMUSG00000025584
Gene Namephosphodiesterase 8A
SynonymsPde8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #K7894 () of strain 468
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location81213596-81334533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81306765 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 304 (P304H)
Ref Sequence ENSEMBL: ENSMUSP00000026672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026672]
Predicted Effect probably damaging
Transcript: ENSMUST00000026672
AA Change: P304H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: P304H

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Blast:REC 79 194 2e-48 BLAST
PAS 211 277 2.18e-2 SMART
Blast:HDc 403 451 4e-11 BLAST
HDc 548 734 5.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130494
Meta Mutation Damage Score 0.9612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Acsl4 C T X: 142,328,060 V632I probably benign Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Olfr652 A G 7: 104,564,532 T104A probably benign Het
Prmt3 A G 7: 49,826,711 Y356C probably damaging Het
Rsph10b A G 5: 143,944,520 D151G probably damaging Het
Spryd3 A G 15: 102,118,141 V365A probably benign Het
Vmn1r58 T C 7: 5,410,703 N176S probably benign Het
Other mutations in Pde8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Pde8a APN 7 81306708 missense possibly damaging 0.62
IGL00808:Pde8a APN 7 81283014 critical splice donor site probably null
IGL01134:Pde8a APN 7 81319078 missense possibly damaging 0.86
IGL01443:Pde8a APN 7 81324181 missense probably damaging 1.00
IGL02044:Pde8a APN 7 81317449 critical splice donor site probably null
IGL02269:Pde8a APN 7 81308802 splice site probably benign
IGL02528:Pde8a APN 7 81293189 splice site probably benign
IGL02738:Pde8a APN 7 81326342 missense probably damaging 1.00
IGL02937:Pde8a APN 7 81295771 splice site probably benign
IGL03072:Pde8a APN 7 81308809 missense probably damaging 1.00
cast_iron UTSW 7 81282807 splice site probably null
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0547:Pde8a UTSW 7 81324130 missense probably benign 0.00
R0552:Pde8a UTSW 7 81317347 missense probably benign 0.12
R1342:Pde8a UTSW 7 81302294 critical splice donor site probably null
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1502:Pde8a UTSW 7 81292259 missense probably damaging 1.00
R1568:Pde8a UTSW 7 81292263 missense probably damaging 1.00
R1768:Pde8a UTSW 7 81300723 splice site probably null
R2076:Pde8a UTSW 7 81308945 missense probably benign 0.11
R2165:Pde8a UTSW 7 81295768 critical splice donor site probably null
R2385:Pde8a UTSW 7 81282992 missense probably benign 0.45
R2518:Pde8a UTSW 7 81317422 missense probably benign 0.00
R4001:Pde8a UTSW 7 81317356 missense probably damaging 1.00
R4114:Pde8a UTSW 7 81282807 splice site probably null
R4115:Pde8a UTSW 7 81282807 splice site probably null
R4159:Pde8a UTSW 7 81320659 missense probably benign 0.13
R4299:Pde8a UTSW 7 81328035 missense probably benign
R4544:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4545:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4561:Pde8a UTSW 7 81308820 nonsense probably null
R4562:Pde8a UTSW 7 81308820 nonsense probably null
R4563:Pde8a UTSW 7 81308820 nonsense probably null
R4615:Pde8a UTSW 7 81320737 missense probably damaging 1.00
R4808:Pde8a UTSW 7 81282931 missense probably benign
R5396:Pde8a UTSW 7 81333422 missense probably damaging 1.00
R5840:Pde8a UTSW 7 81213965 missense probably benign
R5892:Pde8a UTSW 7 81295691 missense probably damaging 0.99
R6621:Pde8a UTSW 7 81293130 critical splice acceptor site probably null
R7067:Pde8a UTSW 7 81317326 missense probably benign 0.41
R7163:Pde8a UTSW 7 81306708 missense possibly damaging 0.62
R7483:Pde8a UTSW 7 81282833 missense probably benign 0.02
R7606:Pde8a UTSW 7 81332967 missense probably damaging 0.98
R7876:Pde8a UTSW 7 81324071 missense probably damaging 1.00
R8046:Pde8a UTSW 7 81308839 missense possibly damaging 0.90
R8046:Pde8a UTSW 7 81317370 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTGAGTACACCTGCACCAAGTACC -3'
(R):5'- AGAGTAGTGGCTCTGGACTGCAAG -3'

Sequencing Primer
(F):5'- CTTCATGCAGCCAGTGAGAG -3'
(R):5'- ACTGCAAGTGGAAGGTCCTC -3'
Posted On2013-04-16