Mutagenetix > Incidental Mutations

Incidental Mutation 'K7894:Adcy8'

26527

Institutional Source

Beutler Lab

Gene Symbol

Adcy8

Ensembl Gene

ENSMUSG00000022376

Gene Name

adenylate cyclase 8

Synonyms

AC8

Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

K7894 () of strain 468

Quality Score

222

Status

Validated (trace)

Chromosome

Chromosomal Location

64697084-64922296 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64822234 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 398 (H398R)

Ref Sequence

ENSEMBL: ENSMUSP00000023007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000180105] [ENSMUST00000228014]

Predicted Effect

probably benign
Transcript: ENSMUST00000023007
AA Change: H398R

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: H398R

Domain	Start	End	E-Value	Type
low complexity region	52	61	N/A	INTRINSIC
low complexity region	111	123	N/A	INTRINSIC
low complexity region	185	201	N/A	INTRINSIC
low complexity region	255	271	N/A	INTRINSIC
CYCc	363	565	3.16e-63	SMART
Pfam:DUF1053	615	710	1.3e-30	PFAM
transmembrane domain	741	759	N/A	INTRINSIC
transmembrane domain	780	802	N/A	INTRINSIC
transmembrane domain	833	852	N/A	INTRINSIC
transmembrane domain	857	879	N/A	INTRINSIC
low complexity region	900	911	N/A	INTRINSIC
CYCc	940	1155	2.19e-48	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180105

SMART Domains

Protein: ENSMUSP00000136962
Gene: ENSMUSG00000094296

Domain	Start	End	E-Value	Type
low complexity region	60	87	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228014
AA Change: H398R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228109

Meta Mutation Damage Score

0.0664

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 95.4%

Validation Efficiency

88% (22/25)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	CAA	3: 122,147,868		probably null	Het
Acsl4	C	T	X: 142,328,060	V632I	probably benign	Het
Catsperg1	C	T	7: 29,197,154		probably benign	Het
Ccpg1	T	C	9: 73,001,877		probably null	Het
Clk4	G	T	11: 51,275,766		probably benign	Het
Ehbp1	C	T	11: 22,089,683		probably benign	Het
Eri2	T	C	7: 119,785,271	D669G	probably benign	Het
Nlrp9c	A	G	7: 26,384,898	S419P	possibly damaging	Het
Olfr652	A	G	7: 104,564,532	T104A	probably benign	Het
Pde8a	C	A	7: 81,306,765	P304H	probably damaging	Het
Prmt3	A	G	7: 49,826,711	Y356C	probably damaging	Het
Rsph10b	A	G	5: 143,944,520	D151G	probably damaging	Het
Spryd3	A	G	15: 102,118,141	V365A	probably benign	Het
Vmn1r58	T	C	7: 5,410,703	N176S	probably benign	Het

Other mutations in Adcy8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Adcy8	APN	15	64787367	missense	probably damaging	1.00
IGL00690:Adcy8	APN	15	64699302	missense	probably damaging	1.00
IGL00990:Adcy8	APN	15	64822313	missense	probably benign	0.07
IGL01083:Adcy8	APN	15	64787342	missense	probably benign	0.21
IGL01296:Adcy8	APN	15	64783779	missense	probably damaging	0.98
IGL01433:Adcy8	APN	15	64737414	missense	possibly damaging	0.63
IGL01584:Adcy8	APN	15	64815321	missense	probably damaging	1.00
IGL01729:Adcy8	APN	15	64806662	missense	probably damaging	1.00
IGL02023:Adcy8	APN	15	64822220	missense	probably damaging	1.00
IGL02420:Adcy8	APN	15	64787454	missense	probably damaging	1.00
IGL02613:Adcy8	APN	15	64783984	missense	possibly damaging	0.82
IGL02662:Adcy8	APN	15	64746895	critical splice donor site	probably null
IGL03180:Adcy8	APN	15	64783950	missense	possibly damaging	0.77
IGL03327:Adcy8	APN	15	64920267	missense	probably damaging	1.00
revolutionary	UTSW	15	64699387	missense	probably damaging	1.00
whirligig	UTSW	15	64699285	missense	probably damaging	1.00
F0336:Adcy8	UTSW	15	64822234	missense	probably benign	0.38
PIT4581001:Adcy8	UTSW	15	64754817	missense	probably damaging	1.00
R0035:Adcy8	UTSW	15	64699368	missense	probably benign	0.29
R0119:Adcy8	UTSW	15	64716166	missense	probably damaging	1.00
R0129:Adcy8	UTSW	15	64747013	missense	probably benign	0.18
R0299:Adcy8	UTSW	15	64716166	missense	probably damaging	1.00
R0573:Adcy8	UTSW	15	64822195	missense	probably damaging	1.00
R0961:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R1203:Adcy8	UTSW	15	64746931	missense	probably damaging	1.00
R1239:Adcy8	UTSW	15	64716062	missense	probably damaging	0.98
R1615:Adcy8	UTSW	15	64871776	missense	probably benign	0.25
R1881:Adcy8	UTSW	15	64806654	missense	probably damaging	0.96
R2013:Adcy8	UTSW	15	64767878	missense	probably benign	0.00
R2014:Adcy8	UTSW	15	64767878	missense	probably benign	0.00
R2015:Adcy8	UTSW	15	64767878	missense	probably benign	0.00
R2164:Adcy8	UTSW	15	64920934	missense	probably benign
R2228:Adcy8	UTSW	15	64822207	missense	possibly damaging	0.58
R2229:Adcy8	UTSW	15	64822207	missense	possibly damaging	0.58
R2241:Adcy8	UTSW	15	64699381	missense	possibly damaging	0.78
R3177:Adcy8	UTSW	15	64699159	missense	probably benign	0.10
R3277:Adcy8	UTSW	15	64699159	missense	probably benign	0.10
R3404:Adcy8	UTSW	15	64699600	missense	probably damaging	1.00
R3688:Adcy8	UTSW	15	64871707	missense	probably damaging	0.99
R3709:Adcy8	UTSW	15	64725535	splice site	probably benign
R3710:Adcy8	UTSW	15	64725535	splice site	probably benign
R3778:Adcy8	UTSW	15	64746997	missense	probably damaging	1.00
R4037:Adcy8	UTSW	15	64725470	missense	probably benign	0.06
R4685:Adcy8	UTSW	15	64737438	missense	probably benign	0.09
R4731:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R4732:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R4733:Adcy8	UTSW	15	64754862	missense	possibly damaging	0.91
R5071:Adcy8	UTSW	15	64787358	missense	probably damaging	1.00
R5073:Adcy8	UTSW	15	64787358	missense	probably damaging	1.00
R5074:Adcy8	UTSW	15	64787358	missense	probably damaging	1.00
R5091:Adcy8	UTSW	15	64806704	missense	probably damaging	1.00
R5285:Adcy8	UTSW	15	64767857	missense	possibly damaging	0.68
R5287:Adcy8	UTSW	15	64716152	missense	probably benign	0.04
R5403:Adcy8	UTSW	15	64716152	missense	probably benign	0.04
R5521:Adcy8	UTSW	15	64815350	missense	probably damaging	1.00
R5633:Adcy8	UTSW	15	64699285	missense	probably damaging	1.00
R5712:Adcy8	UTSW	15	64754866	missense	probably damaging	1.00
R5745:Adcy8	UTSW	15	64920471	missense	possibly damaging	0.91
R5787:Adcy8	UTSW	15	64704218	missense	probably damaging	0.98
R5839:Adcy8	UTSW	15	64716182	missense	probably damaging	1.00
R5890:Adcy8	UTSW	15	64815417	missense	probably damaging	1.00
R6156:Adcy8	UTSW	15	64817639	splice site	probably null
R6338:Adcy8	UTSW	15	64920617	missense	possibly damaging	0.94
R6516:Adcy8	UTSW	15	64699387	missense	probably damaging	1.00
R6525:Adcy8	UTSW	15	64737394	nonsense	probably null
R6636:Adcy8	UTSW	15	64787402	missense	probably damaging	1.00
R6823:Adcy8	UTSW	15	64754886	critical splice acceptor site	probably null
R7007:Adcy8	UTSW	15	64704716	missense	possibly damaging	0.88
R7070:Adcy8	UTSW	15	64920555	missense	probably damaging	1.00
R7092:Adcy8	UTSW	15	64871770	missense	possibly damaging	0.93
R7371:Adcy8	UTSW	15	64699218	missense	probably benign	0.19
R7457:Adcy8	UTSW	15	64920680	missense	possibly damaging	0.79
R7611:Adcy8	UTSW	15	64921033	missense	probably benign
R7644:Adcy8	UTSW	15	64699369	missense	possibly damaging	0.77
R7697:Adcy8	UTSW	15	64747001	missense	probably benign
R7735:Adcy8	UTSW	15	64783780	missense	probably benign	0.10
R7789:Adcy8	UTSW	15	64871774	nonsense	probably null
R7860:Adcy8	UTSW	15	64699473	missense	probably damaging	0.97
R7894:Adcy8	UTSW	15	64920205	missense	possibly damaging	0.60
R7948:Adcy8	UTSW	15	64815350	missense	possibly damaging	0.80
R7966:Adcy8	UTSW	15	64702090	missense	probably damaging	1.00
R8024:Adcy8	UTSW	15	64920246	missense	probably damaging	1.00
R8097:Adcy8	UTSW	15	64871862	splice site	probably null
R8158:Adcy8	UTSW	15	64783806	missense	probably benign	0.32
R8463:Adcy8	UTSW	15	64921025	missense	probably benign
R8474:Adcy8	UTSW	15	64704789	missense	probably damaging	0.98
Z1176:Adcy8	UTSW	15	64725518	missense	probably benign	0.16
Z1177:Adcy8	UTSW	15	64699177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATGCCTCCAGGTGGGATTTTCAG -3'
(R):5'- ACTCTTCCAGCAATCTAAGAGGCTTTG -3'

Sequencing Primer
(F):5'- CCAGTCTCAAACTGGAAATGTAAATG -3'
(R):5'- AAGAGGCTTTGGTCTTCTATACC -3'

Posted On

2013-04-16