Incidental Mutation 'R3085:Pde6d'
ID265555
Institutional Source Beutler Lab
Gene Symbol Pde6d
Ensembl Gene ENSMUSG00000026239
Gene Namephosphodiesterase 6D, cGMP-specific, rod, delta
Synonyms
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86542994-86582629 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 86547526 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027444] [ENSMUST00000143674] [ENSMUST00000146220] [ENSMUST00000146220]
Predicted Effect probably null
Transcript: ENSMUST00000027444
SMART Domains Protein: ENSMUSP00000027444
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 9 149 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143674
AA Change: T48A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137956
Gene: ENSMUSG00000026239
AA Change: T48A

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 64 4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146220
SMART Domains Protein: ENSMUSP00000137820
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 124 6.9e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146220
SMART Domains Protein: ENSMUSP00000137820
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 124 6.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150653
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit progressive retinal degeneration with progressive loss of rod and cone neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Pde6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
costume UTSW 1 86547526 splice site probably null
R0879:Pde6d UTSW 1 86545801 missense probably benign 0.04
R1446:Pde6d UTSW 1 86546692 missense probably damaging 0.99
R2018:Pde6d UTSW 1 86546716 missense probably damaging 1.00
R2118:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2119:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2120:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2122:Pde6d UTSW 1 86545802 missense probably benign 0.10
R3084:Pde6d UTSW 1 86547526 splice site probably null
R6824:Pde6d UTSW 1 86545763 missense possibly damaging 0.49
R7775:Pde6d UTSW 1 86543528 missense probably damaging 1.00
R7778:Pde6d UTSW 1 86543528 missense probably damaging 1.00
R8444:Pde6d UTSW 1 86543528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCTGTGCAGCTGTCAG -3'
(R):5'- AGTTCATGTCTCAGATGTTATGTAAC -3'

Sequencing Primer
(F):5'- CTCAATCTGCAAAGTGCTGG -3'
(R):5'- TTAAAAACCTCTGGAGTCAGCTGG -3'
Posted On2015-02-05