Incidental Mutation 'R3085:Zfp266'
ID265587
Institutional Source Beutler Lab
Gene Symbol Zfp266
Ensembl Gene ENSMUSG00000060510
Gene Namezinc finger protein 266
Synonyms
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20495068-20521417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20500944 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 111 (L111P)
Ref Sequence ENSEMBL: ENSMUSP00000134217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068296] [ENSMUST00000174462] [ENSMUST00000215908]
Predicted Effect probably damaging
Transcript: ENSMUST00000068296
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066012
Gene: ENSMUSG00000060510
AA Change: L111P

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174462
AA Change: L111P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134217
Gene: ENSMUSG00000060510
AA Change: L111P

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Predicted Effect probably damaging
Transcript: ENSMUST00000215908
AA Change: L42P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing many tandem zinc-finger motifs. Zinc fingers are protein or nucleic acid-binding domains, and may be involved in a variety of functions, including regulation of transcription. This gene is located in a cluster of similar genes encoding zinc finger proteins on chromosome 19. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Tshz2 T A 2: 169,883,951 C156S probably benign Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Zfp266
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Zfp266 UTSW 9 20506003 missense probably benign
R0744:Zfp266 UTSW 9 20499799 missense probably damaging 1.00
R0836:Zfp266 UTSW 9 20499799 missense probably damaging 1.00
R2180:Zfp266 UTSW 9 20499679 missense probably damaging 1.00
R2422:Zfp266 UTSW 9 20499262 missense possibly damaging 0.89
R3791:Zfp266 UTSW 9 20499481 missense probably damaging 0.99
R3972:Zfp266 UTSW 9 20500150 missense probably damaging 1.00
R5378:Zfp266 UTSW 9 20499363 missense probably damaging 1.00
R5529:Zfp266 UTSW 9 20506734 missense probably damaging 0.99
R5788:Zfp266 UTSW 9 20506036 missense probably damaging 0.98
R6476:Zfp266 UTSW 9 20499281 missense probably damaging 1.00
R6901:Zfp266 UTSW 9 20499599 nonsense probably null
R7326:Zfp266 UTSW 9 20502095 missense probably benign 0.03
R7417:Zfp266 UTSW 9 20500936 missense probably benign
R7783:Zfp266 UTSW 9 20500330 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGAGCATGCTATTCATCCC -3'
(R):5'- AAGATCACAGTTGTGCACCATTATG -3'

Sequencing Primer
(F):5'- GGAGCATGCTATTCATCCCAAGTATC -3'
(R):5'- ACAGTTGTGCACCATTATGTCTGC -3'
Posted On2015-02-05