Incidental Mutation 'R3085:Tshz2'
ID265565
Institutional Source Beutler Lab
Gene Symbol Tshz2
Ensembl Gene ENSMUSG00000047907
Gene Nameteashirt zinc finger family member 2
SynonymsMtsh2, Sdccag33l, Zfp218, teashirt2, 2900073F20Rik, Tsh2
MMRRC Submission 040574-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3085 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location169633013-170071816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 169883951 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 156 (C156S)
Ref Sequence ENSEMBL: ENSMUSP00000104787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109157] [ENSMUST00000109159] [ENSMUST00000123300] [ENSMUST00000140699] [ENSMUST00000185239]
Predicted Effect probably benign
Transcript: ENSMUST00000109157
AA Change: C156S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104785
Gene: ENSMUSG00000047907
AA Change: C156S

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109159
AA Change: C156S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104787
Gene: ENSMUSG00000047907
AA Change: C156S

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123300
SMART Domains Protein: ENSMUSP00000118550
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
HOX 279 353 1.7e-6 SMART
ZnF_C2H2 365 387 2.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140699
SMART Domains Protein: ENSMUSP00000120013
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
HOX 43 117 1.7e-6 SMART
ZnF_C2H2 129 151 2.3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181446
Predicted Effect probably benign
Transcript: ENSMUST00000185239
SMART Domains Protein: ENSMUSP00000140884
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
low complexity region 129 144 N/A INTRINSIC
low complexity region 178 198 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
HOX 367 441 1.7e-6 SMART
ZnF_C2H2 453 475 2.3e-3 SMART
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the teashirt C2H2-type zinc-finger protein family of transcription factors. This gene encodes a protein with five C2H2-type zinc fingers, a homeobox DNA-binding domain and a coiled-coil domain. This nuclear protein is predicted to act as a transcriptional repressor. This gene is thought to play a role in the development and progression of breast and other types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a transposon induced allele die in utero; cultured blastocysts fail to hatch. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,543,907 probably benign Het
Adrm1 T C 2: 180,174,301 probably null Het
Aldh18a1 T C 19: 40,574,369 I76V probably benign Het
Atp1b2 T C 11: 69,602,879 K125E possibly damaging Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Cdh8 T C 8: 99,196,386 T293A probably benign Het
Cenpc1 A T 5: 86,037,617 V345D probably benign Het
Col4a3 A G 1: 82,651,258 E131G unknown Het
Col4a4 C T 1: 82,529,564 probably null Het
Creb3l1 G T 2: 91,995,444 probably null Het
Dhx9 T C 1: 153,465,699 D601G probably benign Het
Dyx1c1 T A 9: 72,972,406 N289K probably benign Het
Eml6 T C 11: 29,809,332 E807G probably damaging Het
Exog C A 9: 119,462,452 T241K probably benign Het
Eya1 T C 1: 14,274,090 D109G probably benign Het
Fam69a G T 5: 107,914,424 D28E probably damaging Het
Fat2 C T 11: 55,252,171 R4284H possibly damaging Het
Fbxw13 C A 9: 109,184,231 G130* probably null Het
Fcrl5 A G 3: 87,446,464 Y372C probably damaging Het
Gli3 T C 13: 15,660,941 S435P probably damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Havcr1 C T 11: 46,756,225 T162I probably damaging Het
Igdcc4 T C 9: 65,132,058 F947S probably damaging Het
Irx1 G T 13: 71,963,292 A66E probably damaging Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Kynu A G 2: 43,602,300 M190V probably benign Het
Lrp2 T C 2: 69,467,135 T3161A probably benign Het
Macrod1 G T 19: 7,196,494 A208S probably damaging Het
Mamdc2 G A 19: 23,310,932 H581Y possibly damaging Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
Mthfd1l G A 10: 4,090,007 R806H probably benign Het
Nags T A 11: 102,145,984 V133D probably damaging Het
Nrg3 C A 14: 38,370,949 D560Y probably damaging Het
Olfr1198 A G 2: 88,746,144 F248S probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr313 T C 11: 58,817,727 S240P probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pde6d T C 1: 86,547,526 probably null Het
Plekhf1 T C 7: 38,221,577 E189G probably benign Het
Ppm1b A T 17: 85,013,860 I477L probably benign Het
Rad51ap2 C A 12: 11,456,757 Q227K possibly damaging Het
Rnf125 T C 18: 20,977,730 V15A probably benign Het
Rnps1 C T 17: 24,412,419 probably benign Het
Robo1 A G 16: 73,002,010 I953V possibly damaging Het
Sash1 A T 10: 8,742,422 probably null Het
Smarcc2 T C 10: 128,488,159 probably benign Het
Stx12 T A 4: 132,857,361 E224V probably damaging Het
Sun1 T C 5: 139,235,601 V357A probably benign Het
Synpo2l T C 14: 20,662,180 D350G probably damaging Het
Tex15 A T 8: 33,574,885 N1448Y probably benign Het
Tfpi A G 2: 84,442,883 probably benign Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Tmem40 T C 6: 115,741,615 D43G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Vmn2r85 T C 10: 130,425,212 M419V probably benign Het
Wdr73 G A 7: 80,901,242 probably benign Het
Zc3hc1 C T 6: 30,374,764 probably null Het
Zfhx3 T C 8: 108,956,032 Y3368H unknown Het
Zfp263 G A 16: 3,749,716 E632K probably damaging Het
Zfp266 A G 9: 20,500,944 L111P probably damaging Het
Zfp626 T A 7: 27,818,162 S189R probably benign Het
Zfp772 T C 7: 7,203,700 R331G possibly damaging Het
Zkscan5 G A 5: 145,221,079 C797Y probably damaging Het
Other mutations in Tshz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Tshz2 APN 2 169885536 missense possibly damaging 0.87
IGL01973:Tshz2 APN 2 169884683 missense probably damaging 1.00
IGL02209:Tshz2 APN 2 169884764 missense probably damaging 1.00
PIT4504001:Tshz2 UTSW 2 169886051 missense probably damaging 1.00
R0084:Tshz2 UTSW 2 169884366 missense probably damaging 1.00
R1757:Tshz2 UTSW 2 169883923 missense probably benign
R1908:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R2082:Tshz2 UTSW 2 169886215 missense probably damaging 1.00
R2256:Tshz2 UTSW 2 169886477 missense probably damaging 1.00
R2259:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2260:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2444:Tshz2 UTSW 2 169884806 missense probably benign
R3904:Tshz2 UTSW 2 169884387 missense probably damaging 1.00
R4021:Tshz2 UTSW 2 169885862 missense probably damaging 1.00
R4061:Tshz2 UTSW 2 169962325 intron probably benign
R4064:Tshz2 UTSW 2 169962325 intron probably benign
R4113:Tshz2 UTSW 2 169885530 missense probably benign 0.14
R4321:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R4355:Tshz2 UTSW 2 169884938 missense possibly damaging 0.79
R4458:Tshz2 UTSW 2 169885088 missense probably benign 0.29
R4779:Tshz2 UTSW 2 169962681 intron probably benign
R4841:Tshz2 UTSW 2 169886247 missense probably damaging 0.98
R4945:Tshz2 UTSW 2 169883874 missense probably damaging 1.00
R5073:Tshz2 UTSW 2 169962573 intron probably benign
R5110:Tshz2 UTSW 2 169884197 missense possibly damaging 0.48
R5404:Tshz2 UTSW 2 169884320 missense probably benign 0.02
R5425:Tshz2 UTSW 2 169884024 missense probably damaging 1.00
R5473:Tshz2 UTSW 2 169883798 missense probably benign
R5587:Tshz2 UTSW 2 169884342 missense probably damaging 1.00
R5832:Tshz2 UTSW 2 169884045 missense possibly damaging 0.56
R6351:Tshz2 UTSW 2 169884968 missense probably benign 0.16
R6375:Tshz2 UTSW 2 169886019 missense probably damaging 1.00
R6478:Tshz2 UTSW 2 169884664 missense probably damaging 1.00
R6675:Tshz2 UTSW 2 169886045 missense probably damaging 1.00
R6742:Tshz2 UTSW 2 169883757 missense probably damaging 1.00
R7398:Tshz2 UTSW 2 169884174 missense probably damaging 1.00
R7722:Tshz2 UTSW 2 169885272 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGCCGAGATGTTTCAGAC -3'
(R):5'- TCGTTCATGTGCACGGTCAG -3'

Sequencing Primer
(F):5'- CCGAGATGTTTCAGACAAGAAAGC -3'
(R):5'- ACGGTCAGCTCCACGAGAG -3'
Posted On2015-02-05