Incidental Mutation 'R3432:Zfp872'
ID266238
Institutional Source Beutler Lab
Gene Symbol Zfp872
Ensembl Gene ENSMUSG00000074472
Gene Namezinc finger protein 872
Synonyms
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22188090-22202123 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 22200454 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 410 (R410*)
Ref Sequence ENSEMBL: ENSMUSP00000136074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091508] [ENSMUST00000178901] [ENSMUST00000217301]
Predicted Effect probably null
Transcript: ENSMUST00000091508
AA Change: R409*
SMART Domains Protein: ENSMUSP00000089089
Gene: ENSMUSG00000074472
AA Change: R409*

DomainStartEndE-ValueType
KRAB 3 74 6.16e-15 SMART
ZnF_C2H2 99 121 1.64e-1 SMART
ZnF_C2H2 137 159 3.63e-3 SMART
ZnF_C2H2 165 187 5.14e-3 SMART
ZnF_C2H2 193 215 1.58e-3 SMART
ZnF_C2H2 221 243 2.75e-3 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 2.57e-3 SMART
ZnF_C2H2 305 327 2.75e-3 SMART
ZnF_C2H2 333 355 3.58e-2 SMART
ZnF_C2H2 361 383 4.05e-1 SMART
ZnF_C2H2 389 411 2.43e-4 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 463 1.27e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178901
AA Change: R410*
SMART Domains Protein: ENSMUSP00000136074
Gene: ENSMUSG00000074472
AA Change: R410*

DomainStartEndE-ValueType
KRAB 4 75 6.16e-15 SMART
ZnF_C2H2 100 122 1.64e-1 SMART
ZnF_C2H2 138 160 3.63e-3 SMART
ZnF_C2H2 166 188 5.14e-3 SMART
ZnF_C2H2 194 216 1.58e-3 SMART
ZnF_C2H2 222 244 2.75e-3 SMART
ZnF_C2H2 250 272 4.47e-3 SMART
ZnF_C2H2 278 300 2.57e-3 SMART
ZnF_C2H2 306 328 2.75e-3 SMART
ZnF_C2H2 334 356 3.58e-2 SMART
ZnF_C2H2 362 384 4.05e-1 SMART
ZnF_C2H2 390 412 2.43e-4 SMART
ZnF_C2H2 418 440 1.26e-2 SMART
ZnF_C2H2 446 464 1.27e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217297
Predicted Effect probably benign
Transcript: ENSMUST00000217301
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Other mutations in Zfp872
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Zfp872 UTSW 9 22200173 missense probably damaging 0.98
R0211:Zfp872 UTSW 9 22200173 missense probably damaging 0.98
R1162:Zfp872 UTSW 9 22199614 missense possibly damaging 0.84
R1793:Zfp872 UTSW 9 22200053 missense probably damaging 1.00
R4633:Zfp872 UTSW 9 22197194 critical splice donor site probably null
R4647:Zfp872 UTSW 9 22199761 missense possibly damaging 0.80
R4675:Zfp872 UTSW 9 22197405 missense probably damaging 0.99
R6189:Zfp872 UTSW 9 22197131 missense probably benign 0.01
R6240:Zfp872 UTSW 9 22199884 missense probably damaging 1.00
R6852:Zfp872 UTSW 9 22200059 missense probably damaging 1.00
R7001:Zfp872 UTSW 9 22200616 missense probably damaging 1.00
R7036:Zfp872 UTSW 9 22200560 missense probably benign 0.08
R7834:Zfp872 UTSW 9 22200110 missense probably damaging 0.97
R8364:Zfp872 UTSW 9 22200244 missense probably damaging 1.00
R8385:Zfp872 UTSW 9 22200111 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTAAGGAGTGTGGGAAAGCC -3'
(R):5'- CACTGCTGACACTCATAGGGTT -3'

Sequencing Primer
(F):5'- CCAAGCTTTCGAAGGCATGTG -3'
(R):5'- GAGTCCTCTCATGAATTCGGACAG -3'
Posted On2015-02-18