Incidental Mutation 'R3432:Dhrs7c'
ID266246
Institutional Source Beutler Lab
Gene Symbol Dhrs7c
Ensembl Gene ENSMUSG00000033044
Gene Namedehydrogenase/reductase (SDR family) member 7C
Synonyms
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3432 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67798187-67816002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67809873 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 82 (T82I)
Ref Sequence ENSEMBL: ENSMUSP00000130924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168612]
Predicted Effect probably benign
Transcript: ENSMUST00000168612
AA Change: T82I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130924
Gene: ENSMUSG00000033044
AA Change: T82I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:adh_short 38 237 2e-41 PFAM
Pfam:adh_short_C2 43 238 3.4e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fam89b A T 19: 5,731,733 probably null Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Dhrs7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02031:Dhrs7c APN 11 67815889 missense probably benign 0.00
IGL02168:Dhrs7c APN 11 67815867 missense probably benign 0.05
IGL02198:Dhrs7c APN 11 67815802 missense possibly damaging 0.81
R1403:Dhrs7c UTSW 11 67811650 missense probably damaging 1.00
R1403:Dhrs7c UTSW 11 67811650 missense probably damaging 1.00
R1617:Dhrs7c UTSW 11 67815077 missense possibly damaging 0.78
R2380:Dhrs7c UTSW 11 67815864 missense probably benign 0.22
R2972:Dhrs7c UTSW 11 67815871 missense possibly damaging 0.67
R3752:Dhrs7c UTSW 11 67811455 missense probably damaging 1.00
R4498:Dhrs7c UTSW 11 67815880 missense possibly damaging 0.94
R4886:Dhrs7c UTSW 11 67809794 missense probably damaging 0.97
R5202:Dhrs7c UTSW 11 67815801 missense probably benign 0.03
R6140:Dhrs7c UTSW 11 67815074 missense probably damaging 1.00
R7157:Dhrs7c UTSW 11 67809896 critical splice donor site probably null
R7598:Dhrs7c UTSW 11 67811453 critical splice acceptor site probably null
R7774:Dhrs7c UTSW 11 67809815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGACATCAGGAGTCCCTAAG -3'
(R):5'- ATCAGTGCCCAAGCTTCACC -3'

Sequencing Primer
(F):5'- GACAGGAACTCCTTTCTACAGCTC -3'
(R):5'- GCTTCACCCTGACAAGTGATC -3'
Posted On2015-02-18