Incidental Mutation 'R3195:Calb2'
ID267603
Institutional Source Beutler Lab
Gene Symbol Calb2
Ensembl Gene ENSMUSG00000003657
Gene Namecalbindin 2
SynonymsCR, calretinin
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110137502-110168210 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 110157003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003754] [ENSMUST00000212297]
Predicted Effect probably benign
Transcript: ENSMUST00000003754
SMART Domains Protein: ENSMUSP00000003754
Gene: ENSMUSG00000003657

DomainStartEndE-ValueType
EFh 20 48 3.22e-5 SMART
EFh 67 95 1.25e-2 SMART
EFh 111 139 2.01e-6 SMART
EFh 155 183 1.87e0 SMART
EFh 199 227 4.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212297
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular calcium-binding protein belonging to the troponin C superfamily. Members of this protein family have six EF-hand domains which bind calcium. This protein plays a role in diverse cellular functions, including message targeting and intracellular calcium buffering. It also functions as a modulator of neuronal excitability, and is a diagnostic marker for some human diseases, including Hirschsprung disease and some cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous targeted mutants showed normal growth, normal brain histology, and generally normal behavior. Impaired motor coordination was observed in wheel running in young and old mutant mice, and progressive impairment was seen on the runway and horizontal stationary rod tests in older mice. Abnormalities are observed in Purkinje cell firing, altering both simple and complex spikes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Calb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Calb2 APN 8 110145671 missense probably damaging 1.00
IGL02604:Calb2 APN 8 110148528 missense probably damaging 1.00
IGL03250:Calb2 APN 8 110143107 missense probably benign 0.09
R1108:Calb2 UTSW 8 110143128 nonsense probably null
R2007:Calb2 UTSW 8 110168070 missense probably benign 0.40
R3683:Calb2 UTSW 8 110156988 missense probably benign 0.07
R3684:Calb2 UTSW 8 110156988 missense probably benign 0.07
R4523:Calb2 UTSW 8 110148509 splice site probably null
R4661:Calb2 UTSW 8 110168077 missense probably benign 0.04
R4662:Calb2 UTSW 8 110168077 missense probably benign 0.04
R5326:Calb2 UTSW 8 110156978 missense possibly damaging 0.83
R5566:Calb2 UTSW 8 110152700 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CGAAAGACTCTTTAGTGCCAAG -3'
(R):5'- GCTGAGTACTCCAAGGGTAC -3'

Sequencing Primer
(F):5'- AGACTCTTTAGTGCCAAGATTGGAG -3'
(R):5'- CACATTATTAATCTTGAACATGTGCC -3'
Posted On2015-02-18