Incidental Mutation 'R3195:Slc13a4'
ID267596
Institutional Source Beutler Lab
Gene Symbol Slc13a4
Ensembl Gene ENSMUSG00000029843
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms9630060C05Rik, SUT1, SUT-1
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location35267957-35308131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35268926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 595 (V595M)
Ref Sequence ENSEMBL: ENSMUSP00000031868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031868]
Predicted Effect probably damaging
Transcript: ENSMUST00000031868
AA Change: V595M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031868
Gene: ENSMUSG00000029843
AA Change: V595M

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 609 3.2e-105 PFAM
Pfam:CitMHS 45 166 1.1e-15 PFAM
Pfam:CitMHS 251 531 8.9e-18 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display lethality before birth, impaired placental sulfate transport, failure of bone ossification, impaired vascular development, hemorrhaging, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Slc13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc13a4 APN 6 35289824 missense probably benign 0.01
IGL00975:Slc13a4 APN 6 35274975 missense probably benign 0.18
IGL01069:Slc13a4 APN 6 35268882 missense probably damaging 1.00
IGL01319:Slc13a4 APN 6 35307353 splice site probably null
IGL01560:Slc13a4 APN 6 35271603 splice site probably benign
IGL02125:Slc13a4 APN 6 35278288 missense probably benign 0.23
IGL02415:Slc13a4 APN 6 35283237 critical splice donor site probably null
IGL02888:Slc13a4 APN 6 35268840 missense probably benign 0.10
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0047:Slc13a4 UTSW 6 35287362 missense possibly damaging 0.84
R0532:Slc13a4 UTSW 6 35287404 splice site probably null
R0747:Slc13a4 UTSW 6 35278328 missense probably damaging 1.00
R1391:Slc13a4 UTSW 6 35271662 missense probably damaging 0.96
R2106:Slc13a4 UTSW 6 35287864 missense probably damaging 0.99
R2253:Slc13a4 UTSW 6 35280483 missense probably benign 0.00
R3689:Slc13a4 UTSW 6 35268910 missense possibly damaging 0.87
R3698:Slc13a4 UTSW 6 35274957 missense probably benign 0.06
R3785:Slc13a4 UTSW 6 35287892 missense probably damaging 1.00
R3856:Slc13a4 UTSW 6 35271604 splice site probably null
R5400:Slc13a4 UTSW 6 35301842 nonsense probably null
R6142:Slc13a4 UTSW 6 35301783 missense probably damaging 0.99
R6645:Slc13a4 UTSW 6 35268839 missense probably benign 0.19
R6851:Slc13a4 UTSW 6 35301733 missense probably damaging 1.00
R7200:Slc13a4 UTSW 6 35287350 missense possibly damaging 0.56
R7513:Slc13a4 UTSW 6 35283337 intron probably null
R7590:Slc13a4 UTSW 6 35279463 missense possibly damaging 0.90
R7673:Slc13a4 UTSW 6 35276476 missense probably damaging 1.00
R7706:Slc13a4 UTSW 6 35270355 missense possibly damaging 0.92
R8056:Slc13a4 UTSW 6 35268952 missense probably damaging 1.00
Z1176:Slc13a4 UTSW 6 35278292 missense probably damaging 0.96
Z1177:Slc13a4 UTSW 6 35289849 missense possibly damaging 0.75
Z1177:Slc13a4 UTSW 6 35289850 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATAGCCTCCATGTGGGTCTG -3'
(R):5'- CCCATGGGTATGACTTGATGAG -3'

Sequencing Primer
(F):5'- CTCCATGTGGGTCTGGGGTTTATG -3'
(R):5'- ATGATCAGGGCTTTCTGG -3'
Posted On2015-02-18