Incidental Mutation 'R3430:Grin3a'
ID268052
Institutional Source Beutler Lab
Gene Symbol Grin3a
Ensembl Gene ENSMUSG00000039579
Gene Nameglutamate receptor ionotropic, NMDA3A
SynonymsNR3A, A830097C19Rik, NMDAR-L
MMRRC Submission 040648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3430 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49661611-49845744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49792534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 400 (V400L)
Ref Sequence ENSEMBL: ENSMUSP00000091381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect probably benign
Transcript: ENSMUST00000076674
AA Change: V400L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579
AA Change: V400L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093859
AA Change: V400L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: V400L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131797
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ahnak A G 19: 9,006,958 I1869V probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arhgef19 T C 4: 141,256,800 L777P probably benign Het
Atf7ip A G 6: 136,575,324 probably benign Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Bpifa6 A G 2: 153,989,251 I246V probably benign Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Ccdc88a T A 11: 29,448,033 D255E probably damaging Het
Chd7 T C 4: 8,844,517 V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col20a1 T A 2: 181,013,285 L1145* probably null Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dmxl2 T A 9: 54,477,461 N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Htr3a T C 9: 48,907,388 N82S probably benign Het
Il23r A C 6: 67,452,474 S295A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama5 T C 2: 180,196,317 K869E probably benign Het
Lce1d A T 3: 92,685,730 probably benign Het
Lkaaear1 T C 2: 181,697,531 D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 E232G possibly damaging Het
Marf1 A G 16: 14,140,177 probably benign Het
Mpeg1 A T 19: 12,463,128 H650L probably benign Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr389 A T 11: 73,776,539 S263T probably damaging Het
Olfr918 A T 9: 38,673,139 F102I probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
P2ry12 C T 3: 59,218,027 D76N probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Prex2 T G 1: 11,149,854 I683S possibly damaging Het
Prss34 A T 17: 25,299,104 K86I probably benign Het
Ptpn20 T A 14: 33,614,528 V108D possibly damaging Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Rsad2 T C 12: 26,456,419 M1V probably null Het
S1pr5 A G 9: 21,245,082 V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Serpinb3b A T 1: 107,154,695 S280T probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 S253P probably benign Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 I14T possibly damaging Het
Supt16 A T 14: 52,175,359 M559K probably benign Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tbc1d5 T C 17: 50,800,128 K467E probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tmem131 A G 1: 36,808,821 probably benign Het
Tmtc3 A G 10: 100,447,575 F706S probably benign Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 probably benign Het
Other mutations in Grin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Grin3a APN 4 49770589 missense probably damaging 1.00
IGL01541:Grin3a APN 4 49792533 missense probably damaging 0.98
IGL01886:Grin3a APN 4 49702814 missense probably damaging 1.00
IGL02133:Grin3a APN 4 49792946 nonsense probably null
IGL02367:Grin3a APN 4 49702805 missense probably damaging 1.00
IGL02481:Grin3a APN 4 49702868 missense probably damaging 1.00
IGL02830:Grin3a APN 4 49702787 missense possibly damaging 0.94
IGL02945:Grin3a APN 4 49792971 missense possibly damaging 0.86
IGL03174:Grin3a APN 4 49771107 missense probably damaging 1.00
R0266:Grin3a UTSW 4 49665501 nonsense probably null
R0597:Grin3a UTSW 4 49665351 missense probably damaging 1.00
R0849:Grin3a UTSW 4 49665501 nonsense probably null
R1448:Grin3a UTSW 4 49702804 missense probably damaging 1.00
R1640:Grin3a UTSW 4 49844721 missense probably benign
R1751:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1767:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1858:Grin3a UTSW 4 49792437 missense probably benign 0.01
R1860:Grin3a UTSW 4 49665309 missense possibly damaging 0.95
R1924:Grin3a UTSW 4 49844988 missense possibly damaging 0.95
R2035:Grin3a UTSW 4 49771336 missense probably damaging 1.00
R2108:Grin3a UTSW 4 49665510 missense possibly damaging 0.91
R2307:Grin3a UTSW 4 49793033 critical splice acceptor site probably null
R3082:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3083:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3695:Grin3a UTSW 4 49792704 missense possibly damaging 0.81
R3932:Grin3a UTSW 4 49672472 critical splice donor site probably null
R4559:Grin3a UTSW 4 49844555 missense probably damaging 1.00
R4972:Grin3a UTSW 4 49770484 missense probably damaging 1.00
R4982:Grin3a UTSW 4 49665512 missense probably benign 0.03
R5385:Grin3a UTSW 4 49719313 missense probably damaging 1.00
R5423:Grin3a UTSW 4 49770376 intron probably benign
R5478:Grin3a UTSW 4 49792481 missense probably benign 0.00
R5634:Grin3a UTSW 4 49792843 missense probably damaging 1.00
R5790:Grin3a UTSW 4 49792717 missense probably damaging 1.00
R5976:Grin3a UTSW 4 49792602 missense probably damaging 1.00
R6271:Grin3a UTSW 4 49792516 missense probably benign 0.00
R6451:Grin3a UTSW 4 49844969 missense probably damaging 1.00
R6538:Grin3a UTSW 4 49770856 missense probably damaging 1.00
R6629:Grin3a UTSW 4 49844991 missense probably damaging 1.00
R7217:Grin3a UTSW 4 49770741 missense possibly damaging 0.81
R7337:Grin3a UTSW 4 49702762 missense probably damaging 1.00
R7338:Grin3a UTSW 4 49771238 missense probably benign
R7477:Grin3a UTSW 4 49719278 missense probably damaging 1.00
Z1176:Grin3a UTSW 4 49770622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCAAACTTTATCAGGAC -3'
(R):5'- GTTTGGGCTATCACCTCCTG -3'

Sequencing Primer
(F):5'- CAAGATTTCTGCACAGTGGC -3'
(R):5'- GATCTTCACTGGGTTTTAGGAGACTC -3'
Posted On2015-02-18