Mutagenetix > Incidental Mutations

Incidental Mutation 'R8313:Grin3a'

641487

Institutional Source

Beutler Lab

Gene Symbol

Grin3a

Ensembl Gene

ENSMUSG00000039579

Gene Name

glutamate receptor ionotropic, NMDA3A

Synonyms

NR3A, A830097C19Rik, NMDAR-L

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8313 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49661611-49845744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 49665599 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1012 (T1012I)

Ref Sequence

ENSEMBL: ENSMUSP00000091381 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]

Predicted Effect

probably benign
Transcript: ENSMUST00000076674

SMART Domains

Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	161	181	N/A	INTRINSIC
Lig_chan-Glu_bd	557	622	9.62e-22	SMART
PBPe	565	910	1.43e-73	SMART
transmembrane domain	934	956	N/A	INTRINSIC
coiled coil region	1063	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093859
AA Change: T1012I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: T1012I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	161	181	N/A	INTRINSIC
Lig_chan-Glu_bd	557	622	9.62e-22	SMART
PBPe	565	910	1.43e-73	SMART
transmembrane domain	934	956	N/A	INTRINSIC
coiled coil region	1083	1125	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atl2	C	T	17: 79,852,604	W518*	probably null	Het
Atp13a2	G	A	4: 141,002,735	V646I	probably benign	Het
Bcar1	A	T	8: 111,713,638	F575I	probably benign	Het
Bpifa6	T	A	2: 153,989,258	L248*	probably null	Het
Ccdc38	T	C	10: 93,563,249	L193P	probably damaging	Het
Ch25h	A	C	19: 34,474,738	I130S	probably benign	Het
Chaf1a	C	A	17: 56,044,109	Q30K	unknown	Het
Dab2ip	T	C	2: 35,727,428	L1106S	probably damaging	Het
Dnah3	A	G	7: 119,951,152	Y3315H	probably benign	Het
Dnah7b	G	A	1: 46,175,296	V1074I	possibly damaging	Het
Efemp1	A	G	11: 28,910,691	Q200R	probably benign	Het
Epx	C	T	11: 87,872,731	R221Q	possibly damaging	Het
Exosc7	T	C	9: 123,127,877	L109P	probably damaging	Het
Fam150b	G	T	12: 30,884,851	G23V	probably damaging	Het
Fbxo22	T	A	9: 55,221,060	F222I	probably damaging	Het
Fcgbp	A	G	7: 28,086,344	D402G	probably benign	Het
Foxr1	A	G	9: 44,436,054	V62A	probably damaging	Het
Gm2016	A	T	12: 87,876,994	D137V	unknown	Het
Gm8267	A	T	14: 44,724,058	H59Q	probably damaging	Het
Gnptab	T	A	10: 88,439,209	Y1090N	probably damaging	Het
Gpr20	A	G	15: 73,696,312	F76S	probably damaging	Het
Gpr33	A	G	12: 52,024,124	V44A	probably benign	Het
Itga1	T	A	13: 114,966,584	T1104S	probably benign	Het
Kidins220	T	A	12: 25,004,111	Y537N	probably damaging	Het
Lama1	A	G	17: 67,750,520	T530A		Het
Lysmd2	A	T	9: 75,625,758		probably benign	Het
Mdk	T	C	2: 91,930,833	K128E	unknown	Het
Mphosph8	AC	A	14: 56,678,605		probably null	Het
Muc16	A	C	9: 18,525,147	L7915W	possibly damaging	Het
Muc4	A	T	16: 32,753,423	T1100S	probably benign	Het
Mxra7	T	C	11: 116,804,550	Y176C	probably damaging	Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Myo18b	A	G	5: 112,875,179	S116P	unknown	Het
Noc3l	A	G	19: 38,795,810	L543P	probably damaging	Het
Olfr1355	C	T	10: 78,879,336	P55S	probably benign	Het
Olfr192	C	T	16: 59,098,641	G117D	unknown	Het
Olfr250	T	A	9: 38,368,050	V168E	probably damaging	Het
Pkm	G	T	9: 59,668,619	R106L	probably benign	Het
Prkab2	G	T	3: 97,663,595	V112F	probably benign	Het
Prkaca	A	T	8: 83,990,522	N172Y	probably damaging	Het
Prmt8	A	G	6: 127,689,850	V387A	probably benign	Het
Rad17	T	C	13: 100,624,566	T485A	probably benign	Het
Rita1	G	T	5: 120,609,651	T194K	possibly damaging	Het
Rogdi	C	A	16: 5,013,449		probably benign	Het
Senp5	T	C	16: 31,989,299	D379G	probably benign	Het
Slc4a4	A	G	5: 89,046,263	K201E	possibly damaging	Het
Slc9a4	C	T	1: 40,580,360		probably benign	Het
Tmem175	T	A	5: 108,643,209	S208R	probably benign	Het
Tmem237	A	T	1: 59,108,078	Y299N	probably damaging	Het
Tnrc6a	T	A	7: 123,170,713	N575K	possibly damaging	Het
Trak2	A	T	1: 58,921,147	C232*	probably null	Het
Ubr3	A	G	2: 69,945,134	H589R	probably damaging	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r208	G	C	13: 22,772,777	I183M	probably benign	Het
Vmn1r231	C	T	17: 20,890,027	V209I	probably benign	Het
Vmn1r80	T	C	7: 12,193,067	F35L	probably benign	Het
Vmn2r58	A	T	7: 41,872,528	I48N	probably benign	Het
Vstm2a	T	A	11: 16,281,898	V231E	probably damaging	Het
Zfp108	A	C	7: 24,260,662	Y226S	possibly damaging	Het
Zfp445	A	T	9: 122,853,630	N415K	possibly damaging	Het
Zfp938	T	G	10: 82,225,588	R399S	possibly damaging	Het
Zmym4	G	A	4: 126,910,969	H464Y	probably benign	Het

Other mutations in Grin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Grin3a	APN	4	49770589	missense	probably damaging	1.00
IGL01541:Grin3a	APN	4	49792533	missense	probably damaging	0.98
IGL01886:Grin3a	APN	4	49702814	missense	probably damaging	1.00
IGL02133:Grin3a	APN	4	49792946	nonsense	probably null
IGL02367:Grin3a	APN	4	49702805	missense	probably damaging	1.00
IGL02481:Grin3a	APN	4	49702868	missense	probably damaging	1.00
IGL02830:Grin3a	APN	4	49702787	missense	possibly damaging	0.94
IGL02945:Grin3a	APN	4	49792971	missense	possibly damaging	0.86
IGL03174:Grin3a	APN	4	49771107	missense	probably damaging	1.00
R0266:Grin3a	UTSW	4	49665501	nonsense	probably null
R0597:Grin3a	UTSW	4	49665351	missense	probably damaging	1.00
R0849:Grin3a	UTSW	4	49665501	nonsense	probably null
R1448:Grin3a	UTSW	4	49702804	missense	probably damaging	1.00
R1640:Grin3a	UTSW	4	49844721	missense	probably benign
R1751:Grin3a	UTSW	4	49844423	missense	probably damaging	1.00
R1767:Grin3a	UTSW	4	49844423	missense	probably damaging	1.00
R1858:Grin3a	UTSW	4	49792437	missense	probably benign	0.01
R1860:Grin3a	UTSW	4	49665309	missense	possibly damaging	0.95
R1924:Grin3a	UTSW	4	49844988	missense	possibly damaging	0.95
R2035:Grin3a	UTSW	4	49771336	missense	probably damaging	1.00
R2108:Grin3a	UTSW	4	49665510	missense	possibly damaging	0.91
R2307:Grin3a	UTSW	4	49793033	critical splice acceptor site	probably null
R3082:Grin3a	UTSW	4	49665243	missense	probably benign	0.00
R3083:Grin3a	UTSW	4	49665243	missense	probably benign	0.00
R3430:Grin3a	UTSW	4	49792534	missense	probably benign	0.01
R3695:Grin3a	UTSW	4	49792704	missense	possibly damaging	0.81
R3932:Grin3a	UTSW	4	49672472	critical splice donor site	probably null
R4559:Grin3a	UTSW	4	49844555	missense	probably damaging	1.00
R4972:Grin3a	UTSW	4	49770484	missense	probably damaging	1.00
R4982:Grin3a	UTSW	4	49665512	missense	probably benign	0.03
R5385:Grin3a	UTSW	4	49719313	missense	probably damaging	1.00
R5423:Grin3a	UTSW	4	49770376	intron	probably benign
R5478:Grin3a	UTSW	4	49792481	missense	probably benign	0.00
R5634:Grin3a	UTSW	4	49792843	missense	probably damaging	1.00
R5790:Grin3a	UTSW	4	49792717	missense	probably damaging	1.00
R5976:Grin3a	UTSW	4	49792602	missense	probably damaging	1.00
R6271:Grin3a	UTSW	4	49792516	missense	probably benign	0.00
R6451:Grin3a	UTSW	4	49844969	missense	probably damaging	1.00
R6538:Grin3a	UTSW	4	49770856	missense	probably damaging	1.00
R6629:Grin3a	UTSW	4	49844991	missense	probably damaging	1.00
R7217:Grin3a	UTSW	4	49770741	missense	possibly damaging	0.81
R7337:Grin3a	UTSW	4	49702762	missense	probably damaging	1.00
R7338:Grin3a	UTSW	4	49771238	missense	probably benign
R7477:Grin3a	UTSW	4	49719278	missense	probably damaging	1.00
R8090:Grin3a	UTSW	4	49714224	missense	probably damaging	1.00
Z1176:Grin3a	UTSW	4	49770622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGGTGGTCAGTGAAGCAG -3'
(R):5'- TTCCCATTTCATCAGAAGACATCC -3'

Sequencing Primer
(F):5'- AGCTCTCTTCTCCTTGGAGGG -3'
(R):5'- AGACATCCAATTCTAGTTTCAAAGC -3'

Posted On

2020-07-28