Mutagenetix > Incidental Mutation

Incidental Mutation 'R3686:Sgo2b'

269528

Institutional Source

Beutler Lab

Gene Symbol

Sgo2b

Ensembl Gene

ENSMUSG00000094443

Gene Name

shugoshin 2B

Synonyms

Gm4975, Sgol2b

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R3686 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64377728-64405204 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64384361 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 212 (K212E)

Ref Sequence

ENSEMBL: ENSMUSP00000136323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179944]

AlphaFold

J3QMK1

Predicted Effect

probably benign
Transcript: ENSMUST00000179944
AA Change: K212E

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: K212E

Domain	Start	End	E-Value	Type
coiled coil region	54	113	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	400	414	N/A	INTRINSIC
internal_repeat_1	528	618	9.12e-8	PROSPERO
internal_repeat_1	713	809	9.12e-8	PROSPERO
low complexity region	1009	1024	N/A	INTRINSIC
low complexity region	1059	1081	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1130	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210915

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb16	T	A	11: 102,159,885 (GRCm39)	D79E	probably benign	Het
Atp4a	G	A	7: 30,419,650 (GRCm39)	R671Q	probably benign	Het
B230307C23Rik	T	A	16: 97,810,199 (GRCm39)	N62K	probably benign	Het
B3galnt2	G	A	13: 14,150,220 (GRCm39)		probably null	Het
Bnip2	T	A	9: 69,906,432 (GRCm39)	Y118N	probably damaging	Het
Bptf	C	A	11: 106,965,024 (GRCm39)	R1275L	probably benign	Het
Cacna1g	T	C	11: 94,349,916 (GRCm39)		probably null	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
Cdh4	T	C	2: 179,422,160 (GRCm39)	S95P	probably benign	Het
Ceacam5	G	A	7: 17,494,748 (GRCm39)	E919K	possibly damaging	Het
Eftud2	T	C	11: 102,735,027 (GRCm39)	E624G	probably damaging	Het
Hr	T	A	14: 70,795,236 (GRCm39)	N289K	probably damaging	Het
Hsp90ab1	A	G	17: 45,880,214 (GRCm39)	Y110H	probably damaging	Het
Map3k1	A	G	13: 111,890,425 (GRCm39)	V1258A	probably damaging	Het
Naa11	A	T	5: 97,539,648 (GRCm39)	V170E	probably benign	Het
Nmd3	C	T	3: 69,654,095 (GRCm39)	R413C	probably damaging	Het
Or4k51	G	T	2: 111,584,914 (GRCm39)	V107F	probably benign	Het
Or56b2	A	G	7: 104,337,599 (GRCm39)	I126V	probably benign	Het
Pgm3	G	T	9: 86,441,563 (GRCm39)	P345T	probably benign	Het
Ptpn14	C	A	1: 189,583,596 (GRCm39)	D814E	probably damaging	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Rap1gap2	C	A	11: 74,298,148 (GRCm39)	A491S	possibly damaging	Het
Ros1	A	T	10: 52,021,912 (GRCm39)	V624E	probably damaging	Het
Shisa2	T	A	14: 59,867,228 (GRCm39)	L160Q	probably damaging	Het
Strn4	A	G	7: 16,556,506 (GRCm39)	Y123C	probably damaging	Het
Sycp2	T	C	2: 178,016,177 (GRCm39)	T762A	probably benign	Het
Tiam2	A	G	17: 3,471,959 (GRCm39)	K534E	possibly damaging	Het
Trdn	A	T	10: 33,344,185 (GRCm39)	D633V	probably benign	Het
Ttn	T	C	2: 76,747,333 (GRCm39)	Y4572C	possibly damaging	Het
Unc79	T	A	12: 103,054,920 (GRCm39)	N921K	probably damaging	Het
Vmn2r66	A	G	7: 84,644,397 (GRCm39)	V671A	probably damaging	Het
Wdr86	T	A	5: 24,923,339 (GRCm39)	T118S	probably damaging	Het
Zfp446	T	A	7: 12,716,580 (GRCm39)	I517N	probably damaging	Het
Zfp830	G	A	11: 82,656,188 (GRCm39)	E331K	possibly damaging	Het

Other mutations in Sgo2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sgo2b	APN	8	64,379,557 (GRCm39)	missense	probably benign
IGL01343:Sgo2b	APN	8	64,380,349 (GRCm39)	nonsense	probably null
IGL02027:Sgo2b	APN	8	64,379,863 (GRCm39)	missense	probably benign
IGL02090:Sgo2b	APN	8	64,380,123 (GRCm39)	missense	probably damaging	0.99
IGL02121:Sgo2b	APN	8	64,384,316 (GRCm39)	missense	possibly damaging	0.94
IGL02206:Sgo2b	APN	8	64,394,118 (GRCm39)	missense	possibly damaging	0.94
IGL02554:Sgo2b	APN	8	64,379,571 (GRCm39)	missense	probably damaging	0.96
IGL02663:Sgo2b	APN	8	64,396,148 (GRCm39)	missense	probably damaging	0.97
IGL03149:Sgo2b	APN	8	64,379,617 (GRCm39)	missense	probably benign	0.14
floater	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0164:Sgo2b	UTSW	8	64,391,417 (GRCm39)	missense	possibly damaging	0.92
R0201:Sgo2b	UTSW	8	64,379,670 (GRCm39)	missense	probably benign
R0285:Sgo2b	UTSW	8	64,381,823 (GRCm39)	nonsense	probably null
R0325:Sgo2b	UTSW	8	64,381,410 (GRCm39)	missense	probably benign	0.20
R0727:Sgo2b	UTSW	8	64,380,816 (GRCm39)	missense	probably damaging	0.98
R0943:Sgo2b	UTSW	8	64,384,369 (GRCm39)	missense	possibly damaging	0.82
R1148:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1266:Sgo2b	UTSW	8	64,381,455 (GRCm39)	missense	probably benign	0.00
R1484:Sgo2b	UTSW	8	64,384,507 (GRCm39)	missense	possibly damaging	0.77
R1493:Sgo2b	UTSW	8	64,379,889 (GRCm39)	missense	probably damaging	0.99
R1537:Sgo2b	UTSW	8	64,379,536 (GRCm39)	missense	possibly damaging	0.94
R1630:Sgo2b	UTSW	8	64,380,831 (GRCm39)	missense	possibly damaging	0.90
R1803:Sgo2b	UTSW	8	64,380,426 (GRCm39)	missense	probably benign	0.01
R1912:Sgo2b	UTSW	8	64,384,503 (GRCm39)	missense	probably damaging	0.98
R1993:Sgo2b	UTSW	8	64,379,867 (GRCm39)	missense	probably benign	0.36
R2042:Sgo2b	UTSW	8	64,381,561 (GRCm39)	missense	probably benign
R2130:Sgo2b	UTSW	8	64,380,181 (GRCm39)	missense	probably benign	0.09
R2146:Sgo2b	UTSW	8	64,381,057 (GRCm39)	missense	probably benign	0.00
R2881:Sgo2b	UTSW	8	64,380,570 (GRCm39)	missense	probably damaging	0.99
R3706:Sgo2b	UTSW	8	64,381,179 (GRCm39)	missense	probably damaging	0.98
R3889:Sgo2b	UTSW	8	64,380,777 (GRCm39)	missense	possibly damaging	0.82
R3894:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R3895:Sgo2b	UTSW	8	64,381,767 (GRCm39)	missense	possibly damaging	0.91
R4058:Sgo2b	UTSW	8	64,379,981 (GRCm39)	missense	probably damaging	0.98
R4259:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4260:Sgo2b	UTSW	8	64,381,330 (GRCm39)	missense	probably benign	0.06
R4704:Sgo2b	UTSW	8	64,380,824 (GRCm39)	missense	probably damaging	0.98
R4815:Sgo2b	UTSW	8	64,384,448 (GRCm39)	missense	probably benign
R4922:Sgo2b	UTSW	8	64,379,664 (GRCm39)	missense	possibly damaging	0.66
R5232:Sgo2b	UTSW	8	64,381,636 (GRCm39)	missense	possibly damaging	0.55
R5262:Sgo2b	UTSW	8	64,396,171 (GRCm39)	missense	probably damaging	0.99
R5444:Sgo2b	UTSW	8	64,379,590 (GRCm39)	missense	possibly damaging	0.90
R5677:Sgo2b	UTSW	8	64,380,008 (GRCm39)	missense	possibly damaging	0.77
R5959:Sgo2b	UTSW	8	64,380,322 (GRCm39)	missense	probably benign	0.01
R6004:Sgo2b	UTSW	8	64,379,707 (GRCm39)	nonsense	probably null
R6267:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6296:Sgo2b	UTSW	8	64,380,827 (GRCm39)	missense	probably benign
R6328:Sgo2b	UTSW	8	64,381,345 (GRCm39)	nonsense	probably null
R6517:Sgo2b	UTSW	8	64,384,528 (GRCm39)	missense	probably damaging	0.99
R6523:Sgo2b	UTSW	8	64,380,538 (GRCm39)	missense	probably benign	0.11
R6726:Sgo2b	UTSW	8	64,380,769 (GRCm39)	nonsense	probably null
R6957:Sgo2b	UTSW	8	64,384,489 (GRCm39)	small deletion	probably benign
R7031:Sgo2b	UTSW	8	64,393,078 (GRCm39)	missense	possibly damaging	0.94
R7034:Sgo2b	UTSW	8	64,379,868 (GRCm39)	missense	probably benign	0.36
R7145:Sgo2b	UTSW	8	64,381,218 (GRCm39)	missense	probably damaging	1.00
R7289:Sgo2b	UTSW	8	64,394,192 (GRCm39)	missense	probably damaging	0.97
R7366:Sgo2b	UTSW	8	64,391,451 (GRCm39)	nonsense	probably null
R7660:Sgo2b	UTSW	8	64,393,108 (GRCm39)	missense	probably benign	0.27
R7761:Sgo2b	UTSW	8	64,379,946 (GRCm39)	missense	probably benign
R7762:Sgo2b	UTSW	8	64,379,531 (GRCm39)	missense	probably benign	0.03
R7822:Sgo2b	UTSW	8	64,380,318 (GRCm39)	missense	probably damaging	0.98
R8111:Sgo2b	UTSW	8	64,396,138 (GRCm39)	missense	probably damaging	0.98
R8129:Sgo2b	UTSW	8	64,381,834 (GRCm39)	missense	possibly damaging	0.90
R8273:Sgo2b	UTSW	8	64,377,735 (GRCm39)	missense	unknown
R8856:Sgo2b	UTSW	8	64,393,091 (GRCm39)	missense	probably null	0.99
R9249:Sgo2b	UTSW	8	64,391,407 (GRCm39)	nonsense	probably null
R9428:Sgo2b	UTSW	8	64,393,067 (GRCm39)	missense	probably damaging	0.99
R9616:Sgo2b	UTSW	8	64,380,274 (GRCm39)	missense	probably benign
R9621:Sgo2b	UTSW	8	64,380,651 (GRCm39)	missense	probably damaging	0.99
RF014:Sgo2b	UTSW	8	64,384,439 (GRCm39)	missense	possibly damaging	0.94
RF055:Sgo2b	UTSW	8	64,396,203 (GRCm39)	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	64,381,456 (GRCm39)	missense	possibly damaging	0.61
Z1088:Sgo2b	UTSW	8	64,380,039 (GRCm39)	missense	probably damaging	1.00
Z1177:Sgo2b	UTSW	8	64,381,419 (GRCm39)	missense	possibly damaging	0.82
Z1177:Sgo2b	UTSW	8	64,380,473 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTCCATGAATCTGACATTTGTCTG -3'
(R):5'- GCCTTTAGGGTTCTATTAACTTCAG -3'

Sequencing Primer
(F):5'- GTAGAAGTTAGCAAGTACAAGTTACC -3'
(R):5'- GACCTCACCTGATACTACTTC -3'

Posted On

2015-02-19