Incidental Mutation 'R1972:Adat1'
ID271603
Institutional Source Beutler Lab
Gene Symbol Adat1
Ensembl Gene ENSMUSG00000031949
Gene Nameadenosine deaminase, tRNA-specific 1
SynonymsmADAT1
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1972 (G1)
Quality Score170
Status Validated
Chromosome8
Chromosomal Location111966908-111992302 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 111990418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000034427] [ENSMUST00000093120] [ENSMUST00000120457] [ENSMUST00000139820] [ENSMUST00000164470]
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034427
SMART Domains Protein: ENSMUSP00000034427
Gene: ENSMUSG00000031949

DomainStartEndE-ValueType
ADEAMc 2 499 4.19e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120457
SMART Domains Protein: ENSMUSP00000113201
Gene: ENSMUSG00000031949

DomainStartEndE-ValueType
Pfam:A_deamin 63 354 8.1e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139820
SMART Domains Protein: ENSMUSP00000117279
Gene: ENSMUSG00000031949

DomainStartEndE-ValueType
ADEAMc 2 453 1e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Lgmn A G 12: 102,395,821 probably benign Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Adat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Adat1 APN 8 111982310 missense probably damaging 1.00
R0212:Adat1 UTSW 8 111987208 missense possibly damaging 0.50
R0559:Adat1 UTSW 8 111982430 missense probably damaging 1.00
R1521:Adat1 UTSW 8 111987235 missense possibly damaging 0.66
R2217:Adat1 UTSW 8 111982496 missense probably benign 0.00
R3807:Adat1 UTSW 8 111990370 missense probably damaging 1.00
R4497:Adat1 UTSW 8 111979362 missense probably benign 0.06
R4553:Adat1 UTSW 8 111990280 missense probably damaging 1.00
R5702:Adat1 UTSW 8 111978072 missense probably benign 0.37
R5960:Adat1 UTSW 8 111982601 missense probably benign 0.00
R6380:Adat1 UTSW 8 111978072 missense probably benign 0.37
R6538:Adat1 UTSW 8 111968462 missense probably benign
R6907:Adat1 UTSW 8 111972161 missense probably benign
R7022:Adat1 UTSW 8 111989862 missense probably damaging 1.00
R7440:Adat1 UTSW 8 111989898 missense probably damaging 0.99
R7606:Adat1 UTSW 8 111982604 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGAATCTTCACCACAGCTGC -3'
(R):5'- AAATAGCTTGTCTTCTGGGCTTC -3'

Sequencing Primer
(F):5'- TGCCAGCAAGGTCCACTC -3'
(R):5'- ACTAGAGATGGCTGGAGT -3'
Posted On2015-03-23