Incidental Mutation 'R3781:Nudt3'
ID272059
Institutional Source Beutler Lab
Gene Symbol Nudt3
Ensembl Gene ENSMUSG00000024213
Gene Namenudix (nucleotide diphosphate linked moiety X)-type motif 3
SynonymsDipp, diphosphoinositol polyphosphate phosphohydrolase, 1110011B09Rik
Accession Numbers

NCBI RefSeq: NM_019837.2; MGI:1928484

Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27579382-27623495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27580808 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 134 (S134P)
Ref Sequence ENSEMBL: ENSMUSP00000156111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025050] [ENSMUST00000062397] [ENSMUST00000114886] [ENSMUST00000156429] [ENSMUST00000176458] [ENSMUST00000176876] [ENSMUST00000231742]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025050
AA Change: S163P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025050
Gene: ENSMUSG00000024213
AA Change: S163P

DomainStartEndE-ValueType
Pfam:NUDIX 17 142 3.9e-20 PFAM
low complexity region 153 165 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000062397
AA Change: S154P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059061
Gene: ENSMUSG00000024213
AA Change: S154P

DomainStartEndE-ValueType
Pfam:NUDIX 17 135 1.5e-18 PFAM
low complexity region 144 156 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114886
AA Change: S134P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110536
Gene: ENSMUSG00000024213
AA Change: S134P

DomainStartEndE-ValueType
Pfam:NUDIX 1 116 1.3e-18 PFAM
low complexity region 124 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133048
Predicted Effect possibly damaging
Transcript: ENSMUST00000156429
AA Change: S111P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000176458
SMART Domains Protein: ENSMUSP00000135175
Gene: ENSMUSG00000024213

DomainStartEndE-ValueType
Pfam:NUDIX 1 58 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176876
SMART Domains Protein: ENSMUSP00000135890
Gene: ENSMUSG00000024213

DomainStartEndE-ValueType
Pfam:NUDIX 17 117 1.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231742
AA Change: S134P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUDT3 belongs to the MutT, or Nudix, protein family. Nudix proteins act as homeostatic checkpoints at important stages in nucleoside phosphate metabolic pathways, guarding against elevated levels of potentially dangerous intermediates, like 8-oxo-dGTP, which promotes AT-to-CG transversions (Safrany et al., 1998 [PubMed 9822604]).[supplied by OMIM, Feb 2011]
Allele List at MGI

All alleles(57) : Targeted(2) Gene trapped(55)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Gnl2 T C 4: 125,037,606 V110A probably damaging Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Nudt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Nudt3 UTSW 17 27596715 splice site probably benign
R1136:Nudt3 UTSW 17 27623106 missense probably benign 0.02
R3782:Nudt3 UTSW 17 27580808 missense possibly damaging 0.83
R5625:Nudt3 UTSW 17 27583228 missense probably damaging 1.00
R7664:Nudt3 UTSW 17 27623175 missense probably benign 0.01
R8475:Nudt3 UTSW 17 27580802 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCAGGAAAGTGCTTGTGAG -3'
(R):5'- ATGAAGTCTGCCTCCCACTCAG -3'

Sequencing Primer
(F):5'- GCAGGAAAGTGCTTGTGAGTTACAC -3'
(R):5'- TCCCACTCAGAGCTGTGC -3'
Posted On2015-03-25