Incidental Mutation 'R3781:Gnl2'
ID272042
Institutional Source Beutler Lab
Gene Symbol Gnl2
Ensembl Gene ENSMUSG00000028869
Gene Nameguanine nucleotide binding protein-like 2 (nucleolar)
SynonymsNgp-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3781 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location125016585-125055380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125037606 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000030684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030684] [ENSMUST00000106176]
Predicted Effect probably damaging
Transcript: ENSMUST00000030684
AA Change: V110A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030684
Gene: ENSMUSG00000028869
AA Change: V110A

DomainStartEndE-ValueType
Pfam:NGP1NT 43 174 1.2e-51 PFAM
SCOP:d1egaa1 178 261 8e-3 SMART
Pfam:FeoB_N 311 398 3.1e-6 PFAM
Pfam:MMR_HSR1 312 432 3.4e-13 PFAM
low complexity region 480 500 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
low complexity region 679 687 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106176
SMART Domains Protein: ENSMUSP00000101782
Gene: ENSMUSG00000028869

DomainStartEndE-ValueType
Pfam:NGP1NT 43 100 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136910
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bap1 T C 14: 31,257,618 I526T possibly damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dysf G A 6: 84,186,509 probably null Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Map3k20 A G 2: 72,402,355 probably benign Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1186 A T 2: 88,526,365 T261S probably benign Het
Olfr1212 G T 2: 88,958,747 E94* probably null Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr573-ps1 T C 7: 102,942,071 I169V probably benign Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Plekha6 A G 1: 133,294,655 E993G probably damaging Het
Psmd4 T A 3: 95,036,728 Y15F probably benign Het
Rad23b C T 4: 55,382,586 T263M probably damaging Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn1r45 C A 6: 89,933,817 R57L probably benign Het
Zfp658 G A 7: 43,573,846 R515H probably benign Het
Other mutations in Gnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Gnl2 APN 4 125047612 splice site probably null
IGL02536:Gnl2 APN 4 125052608 nonsense probably null
IGL03358:Gnl2 APN 4 125052594 missense probably damaging 1.00
PIT4283001:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R0377:Gnl2 UTSW 4 125046382 splice site probably benign
R0419:Gnl2 UTSW 4 125053527 missense probably benign 0.00
R0975:Gnl2 UTSW 4 125048378 missense probably damaging 0.99
R1529:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R1550:Gnl2 UTSW 4 125044234 missense probably damaging 1.00
R1942:Gnl2 UTSW 4 125030164 missense probably benign 0.01
R2095:Gnl2 UTSW 4 125034318 missense probably damaging 1.00
R2125:Gnl2 UTSW 4 125053485 missense probably benign 0.01
R3712:Gnl2 UTSW 4 125046274 missense probably damaging 0.98
R4656:Gnl2 UTSW 4 125040997 nonsense probably null
R4676:Gnl2 UTSW 4 125053473 missense possibly damaging 0.83
R4710:Gnl2 UTSW 4 125053459 missense probably benign 0.01
R4734:Gnl2 UTSW 4 125041018 missense probably benign
R4916:Gnl2 UTSW 4 125043692 missense probably damaging 1.00
R5106:Gnl2 UTSW 4 125053536 critical splice donor site probably null
R5310:Gnl2 UTSW 4 125052840 missense probably benign 0.00
R5506:Gnl2 UTSW 4 125055365 utr 3 prime probably benign
R5967:Gnl2 UTSW 4 125041030 missense probably benign 0.00
R6184:Gnl2 UTSW 4 125054229 critical splice donor site probably null
R6395:Gnl2 UTSW 4 125046265 missense probably damaging 0.99
R6432:Gnl2 UTSW 4 125052560 missense possibly damaging 0.86
R6672:Gnl2 UTSW 4 125048393 missense probably damaging 1.00
R7657:Gnl2 UTSW 4 125030158 missense probably benign 0.00
R8387:Gnl2 UTSW 4 125055334 makesense probably null
R8408:Gnl2 UTSW 4 125044289 missense probably damaging 0.98
RF003:Gnl2 UTSW 4 125043725 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATGGAGATTTGCCTTCTTCCC -3'
(R):5'- TGGATCCACACAGTACTGCG -3'

Sequencing Primer
(F):5'- TTCCCCTGTCAGAAAGCGC -3'
(R):5'- ACTCAATTCACAGTAAGGGTGAC -3'
Posted On2015-03-25