Incidental Mutation 'R3785:Zfp804b'
ID272208
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R3785 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6770153 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 934 (T934M)
Ref Sequence ENSEMBL: ENSMUSP00000130571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164784
AA Change: T934M

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: T934M

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200317
AA Change: T970M

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: T970M

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
R7574:Zfp804b UTSW 5 6772301 missense possibly damaging 0.74
R7609:Zfp804b UTSW 5 6770066 missense possibly damaging 0.90
R7654:Zfp804b UTSW 5 6769458 missense probably damaging 0.97
R7669:Zfp804b UTSW 5 6769362 missense probably damaging 1.00
R7717:Zfp804b UTSW 5 6771293 missense possibly damaging 0.50
R7721:Zfp804b UTSW 5 6771263 missense possibly damaging 0.55
R7830:Zfp804b UTSW 5 6771124 missense probably benign
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACTAAACCATTTATGCCTTTGG -3'
(R):5'- TCTAAGGAGCTGTAGAGGTGGC -3'

Sequencing Primer
(F):5'- GCCTTTGGAAAGATAGTTGTCAC -3'
(R):5'- CACACAGTCAAACATTGCTGTTGG -3'
Posted On2015-03-25