Incidental Mutation 'R3792:Lipe'
ID272588
Institutional Source Beutler Lab
Gene Symbol Lipe
Ensembl Gene ENSMUSG00000003123
Gene Namelipase, hormone sensitive
Synonyms4933403G17Rik, HSL
Accession Numbers

Genbank: NM_010719, NM_001039507; MGI: 96790

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25379527-25398710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25397620 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 299 (K299N)
Ref Sequence ENSEMBL: ENSMUSP00000100811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000074040] [ENSMUST00000105177] [ENSMUST00000149349] [ENSMUST00000200880]
Predicted Effect probably benign
Transcript: ENSMUST00000003207
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074040
SMART Domains Protein: ENSMUSP00000073687
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 126 2.8e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105177
AA Change: K299N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100811
Gene: ENSMUSG00000003123
AA Change: K299N

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149349
AA Change: K299N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123
AA Change: K299N

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200880
SMART Domains Protein: ENSMUSP00000144096
Gene: ENSMUSG00000060188

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 111 2.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations of this locus result in abnormal lipid homeostasis and, in some lines, defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(5) Gene trapped(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Lipe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lipe APN 7 25383552 missense probably damaging 1.00
IGL00517:Lipe APN 7 25388560 unclassified probably null
IGL00817:Lipe APN 7 25388449 missense probably damaging 1.00
IGL01459:Lipe APN 7 25383542 missense probably damaging 1.00
IGL01946:Lipe APN 7 25383276 missense possibly damaging 0.90
IGL02931:Lipe APN 7 25383335 splice site probably benign
IGL02973:Lipe APN 7 25383632 missense probably damaging 0.98
IGL03091:Lipe APN 7 25380755 missense probably damaging 1.00
reservoir UTSW 7 25380143 missense probably damaging 1.00
3-1:Lipe UTSW 7 25397820 missense probably damaging 0.97
PIT4243001:Lipe UTSW 7 25395546 missense probably benign
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0062:Lipe UTSW 7 25398449 missense possibly damaging 0.46
R0432:Lipe UTSW 7 25398488 missense probably benign 0.00
R0528:Lipe UTSW 7 25398476 missense possibly damaging 0.92
R0534:Lipe UTSW 7 25388186 missense possibly damaging 0.66
R1487:Lipe UTSW 7 25384815 missense possibly damaging 0.47
R1502:Lipe UTSW 7 25398147 missense possibly damaging 0.66
R1606:Lipe UTSW 7 25388144 missense probably damaging 1.00
R1713:Lipe UTSW 7 25385325 missense probably damaging 0.99
R2147:Lipe UTSW 7 25388521 missense probably benign 0.01
R3031:Lipe UTSW 7 25384895 missense possibly damaging 0.65
R3110:Lipe UTSW 7 25398423 missense probably benign
R3112:Lipe UTSW 7 25398423 missense probably benign
R4453:Lipe UTSW 7 25397690 missense probably damaging 0.99
R4582:Lipe UTSW 7 25397702 missense probably benign
R4816:Lipe UTSW 7 25380143 missense probably damaging 1.00
R5639:Lipe UTSW 7 25383325 missense probably benign 0.00
R5653:Lipe UTSW 7 25398408 missense probably benign 0.08
R6322:Lipe UTSW 7 25380536 missense probably damaging 1.00
R6575:Lipe UTSW 7 25383324 missense probably benign 0.03
R7065:Lipe UTSW 7 25385178 critical splice donor site probably null
R7250:Lipe UTSW 7 25388660 start gained probably benign
R7485:Lipe UTSW 7 25380611 missense probably benign 0.01
R7636:Lipe UTSW 7 25388617 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ATTCCTTCTCGACAGACTGGG -3'
(R):5'- CAGCAGACATCTCCAGAGTG -3'

Sequencing Primer
(F):5'- CAGACTGGGCTGGGGATG -3'
(R):5'- ACTGTGTTACCGTGTCTGACATAGAG -3'
Posted On2015-03-25