Incidental Mutation 'R3829:Commd9'
ID273873
Institutional Source Beutler Lab
Gene Symbol Commd9
Ensembl Gene ENSMUSG00000027163
Gene NameCOMM domain containing 9
Synonyms1810029F08Rik
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101886247-101901646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101897141 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 93 (N93K)
Ref Sequence ENSEMBL: ENSMUSP00000028584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028584]
Predicted Effect probably benign
Transcript: ENSMUST00000028584
AA Change: N93K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028584
Gene: ENSMUSG00000027163
AA Change: N93K

DomainStartEndE-ValueType
Pfam:HCaRG 15 194 9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156799
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, neural tube edema, and cardiovascular abnormalities including hemorrhages, heart hypoplasia, focal myocardial wall necrosis and narrowing of the dorsal aortas, and alterations in cranial blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Commd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Commd9 APN 2 101895156 nonsense probably null
IGL02232:Commd9 APN 2 101900979 missense probably benign 0.34
IGL03109:Commd9 APN 2 101897170 missense probably benign
R1873:Commd9 UTSW 2 101897157 missense probably benign 0.09
R1933:Commd9 UTSW 2 101901031 missense probably damaging 1.00
R3826:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3828:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3968:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3969:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3970:Commd9 UTSW 2 101897141 missense probably benign 0.18
R4059:Commd9 UTSW 2 101895154 missense possibly damaging 0.93
R4795:Commd9 UTSW 2 101898896 missense probably benign 0.00
R5289:Commd9 UTSW 2 101898894 missense probably benign 0.00
R5426:Commd9 UTSW 2 101898875 missense probably damaging 1.00
R5437:Commd9 UTSW 2 101901028 missense probably damaging 1.00
R7209:Commd9 UTSW 2 101895138 missense possibly damaging 0.94
R7425:Commd9 UTSW 2 101899900 nonsense probably null
R7552:Commd9 UTSW 2 101901065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGTACAGAGCTCCACC -3'
(R):5'- AGGGATGAACAGCTTTCCATTAAG -3'

Sequencing Primer
(F):5'- GTACAGAGCTCCACCCCTGC -3'
(R):5'- CCATTAAGGCAATTAAGCTCTGGGTG -3'
Posted On2015-04-02