Incidental Mutation 'R3825:Nub1'
ID275331
Institutional Source Beutler Lab
Gene Symbol Nub1
Ensembl Gene ENSMUSG00000028954
Gene Namenegative regulator of ubiquitin-like proteins 1
SynonymsNY-REN-18, 4931404D21Rik, 6330412F12Rik, BS4
MMRRC Submission 040774-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R3825 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24685532-24710378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 24707853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 517 (S517T)
Ref Sequence ENSEMBL: ENSMUSP00000143657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068693] [ENSMUST00000068825] [ENSMUST00000197407]
Predicted Effect probably benign
Transcript: ENSMUST00000068693
SMART Domains Protein: ENSMUSP00000064785
Gene: ENSMUSG00000055235

DomainStartEndE-ValueType
WD40 4 43 1.62e-8 SMART
WD40 46 83 3.17e-2 SMART
WD40 86 123 1.9e-5 SMART
WD40 126 179 3e-3 SMART
WD40 182 221 2.78e-7 SMART
WD40 224 261 9.9e-4 SMART
WD40 264 301 1.29e-2 SMART
WD40 304 341 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068825
AA Change: S493T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070265
Gene: ENSMUSG00000028954
AA Change: S493T

DomainStartEndE-ValueType
coiled coil region 37 70 N/A INTRINSIC
PDB:1WJU|A 71 162 2e-45 PDB
low complexity region 167 186 N/A INTRINSIC
UBA 375 412 7.29e-8 SMART
UBA 431 468 1.61e-9 SMART
UBA 490 527 1.95e-8 SMART
low complexity region 539 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127320
SMART Domains Protein: ENSMUSP00000119649
Gene: ENSMUSG00000055235

DomainStartEndE-ValueType
WD40 29 63 1.27e2 SMART
WD40 66 103 6.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196443
Predicted Effect probably benign
Transcript: ENSMUST00000197407
AA Change: S517T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143657
Gene: ENSMUSG00000028954
AA Change: S517T

DomainStartEndE-ValueType
coiled coil region 61 94 N/A INTRINSIC
PDB:1WJU|A 95 186 2e-45 PDB
low complexity region 191 210 N/A INTRINSIC
UBA 399 436 3.5e-10 SMART
UBA 455 492 8.1e-12 SMART
UBA 514 551 9.5e-11 SMART
low complexity region 563 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200337
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a negative regulator of NEDD8, a ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and mutations in that gene can abolish interaction with this protein, which may contribute to the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions in multiple system atrophy, with this abnormal accumulation being specific to alpha-synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,802,913 K69E probably damaging Het
Abcb5 C T 12: 118,901,352 probably null Het
Acot1 G T 12: 84,014,420 G167* probably null Het
Agbl1 C T 7: 76,419,967 H164Y probably damaging Het
Atp4b T C 8: 13,393,549 Y43C probably damaging Het
Bsn T C 9: 108,106,856 D3333G unknown Het
Ccdc27 A C 4: 154,036,285 D351E unknown Het
Cd200r4 T C 16: 44,820,950 F19L probably benign Het
Dbndd1 T A 8: 123,509,992 I75F probably damaging Het
Dennd5b T C 6: 149,044,836 K426E probably benign Het
Drg2 A G 11: 60,459,508 T98A possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fmo1 T C 1: 162,851,347 probably benign Het
Foxn2 A T 17: 88,484,409 I236F probably damaging Het
Glmp G A 3: 88,326,411 V107I probably damaging Het
Gm5434 T C 12: 36,091,037 probably benign Het
Gm8979 T C 7: 106,083,573 I158M possibly damaging Het
Gpr15 A G 16: 58,718,360 F122S probably damaging Het
Hmcn1 A T 1: 150,586,965 D5140E probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Igfbp4 A G 11: 99,048,235 E27G probably damaging Het
Il7 A G 3: 7,577,166 probably benign Het
Kat6a G T 8: 22,862,364 V55F probably damaging Het
Kynu A G 2: 43,681,439 T456A probably benign Het
Lcorl A G 5: 45,775,387 probably benign Het
Lrp5 G A 19: 3,605,290 R1077* probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 T A 4: 123,444,951 D1436V probably benign Het
Map4k2 C A 19: 6,344,051 T252N probably benign Het
Mterf2 A T 10: 85,120,283 L159Q probably damaging Het
Muc5ac C A 7: 141,814,723 T3063K possibly damaging Het
Myo18a T A 11: 77,777,466 S51T possibly damaging Het
Ncoa3 G T 2: 166,054,798 G503V possibly damaging Het
Ncor1 A T 11: 62,373,357 H406Q probably benign Het
Nectin2 T C 7: 19,724,585 K434E possibly damaging Het
Nipal2 A T 15: 34,578,706 probably null Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr17 T C 7: 107,097,609 L48P possibly damaging Het
Olfr888 A T 9: 38,108,838 I51F possibly damaging Het
Olfr895 T G 9: 38,268,518 S2A probably benign Het
Plscr3 G A 11: 69,850,138 V267M probably benign Het
Plxnb2 G T 15: 89,166,399 N451K probably benign Het
Ppp2r2a A G 14: 67,022,443 L268P probably damaging Het
Ptprb A T 10: 116,350,789 I1743F probably benign Het
Rack1 A G 11: 48,802,304 T105A probably benign Het
Rhot1 G A 11: 80,226,081 V94I probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Smc6 T A 12: 11,301,516 probably benign Het
Spink8 T A 9: 109,816,793 V11D probably damaging Het
Ss18l1 A T 2: 180,063,310 Q365L unknown Het
Tbc1d31 T A 15: 57,916,078 H62Q probably benign Het
Tbc1d9b T C 11: 50,171,127 V1171A possibly damaging Het
Tln1 G A 4: 43,536,413 probably benign Het
Tmem220 G A 11: 67,025,251 A25T possibly damaging Het
Tmem259 T C 10: 79,978,448 N334S possibly damaging Het
Tmod3 A T 9: 75,507,527 probably benign Het
Tmprss2 A T 16: 97,596,821 Y52N probably damaging Het
Tsga10 A T 1: 37,834,197 N200K possibly damaging Het
Vmn1r189 T A 13: 22,102,212 T152S probably benign Het
Vmn2r76 C T 7: 86,231,207 M90I probably benign Het
Zfr C T 15: 12,166,191 A849V probably damaging Het
Znhit6 T C 3: 145,578,344 M95T probably benign Het
Other mutations in Nub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Nub1 APN 5 24689394 start codon destroyed probably null 0.99
IGL02626:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02629:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02633:Nub1 APN 5 24692933 missense probably benign 0.00
IGL02798:Nub1 APN 5 24692814 missense probably damaging 1.00
IGL03384:Nub1 APN 5 24697427 splice site probably benign
IGL03384:Nub1 APN 5 24697426 splice site probably null
R2484:Nub1 UTSW 5 24708702 missense possibly damaging 0.91
R2679:Nub1 UTSW 5 24692925 missense possibly damaging 0.93
R4180:Nub1 UTSW 5 24692877 missense probably damaging 0.99
R4593:Nub1 UTSW 5 24709121 missense probably damaging 1.00
R4921:Nub1 UTSW 5 24701469 missense probably benign 0.38
R5175:Nub1 UTSW 5 24702448 missense probably benign 0.28
R5282:Nub1 UTSW 5 24695535 missense probably benign 0.04
R5346:Nub1 UTSW 5 24697416 missense probably damaging 0.96
R5533:Nub1 UTSW 5 24702381 missense possibly damaging 0.93
R5567:Nub1 UTSW 5 24708816 missense possibly damaging 0.54
R5802:Nub1 UTSW 5 24702441 missense possibly damaging 0.95
R6966:Nub1 UTSW 5 24689472 missense probably damaging 1.00
R6967:Nub1 UTSW 5 24708711 missense probably benign
R7540:Nub1 UTSW 5 24701529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCACAAGAGGACAGTCTG -3'
(R):5'- TGACATCCTCTTAGGTCCCAGG -3'

Sequencing Primer
(F):5'- CAAGAGGACAGTCTGCGCTG -3'
(R):5'- GAGTGTAACTATATAGCCCTGGCC -3'
Posted On2015-04-02