Incidental Mutation 'R3850:Wfs1'
ID275866
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Namewolframin ER transmembrane glycoprotein
Synonymswolframin
MMRRC Submission 040898-MU
Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R3850 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location36966104-36989205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36968624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 308 (V308L)
Ref Sequence ENSEMBL: ENSMUSP00000048053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
Predicted Effect probably benign
Transcript: ENSMUST00000043964
AA Change: V308L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: V308L

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166339
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Plod2 A G 9: 92,542,545 E29G probably benign Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 36967917 nonsense probably null
IGL01391:Wfs1 APN 5 36971563 missense probably benign 0.10
IGL01788:Wfs1 APN 5 36968636 missense probably benign 0.01
IGL02169:Wfs1 APN 5 36968479 missense probably damaging 0.99
IGL02814:Wfs1 APN 5 36967669 missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 36975597 missense probably damaging 1.00
IGL03299:Wfs1 APN 5 36968387 nonsense probably null
2107:Wfs1 UTSW 5 36967273 missense probably damaging 1.00
R0077:Wfs1 UTSW 5 36973194 missense probably damaging 1.00
R0180:Wfs1 UTSW 5 36967028 missense probably damaging 0.96
R0402:Wfs1 UTSW 5 36976980 unclassified probably benign
R0458:Wfs1 UTSW 5 36968669 missense probably damaging 0.98
R0533:Wfs1 UTSW 5 36973722 splice site probably benign
R0890:Wfs1 UTSW 5 36975544 missense probably damaging 1.00
R0948:Wfs1 UTSW 5 36967561 missense probably damaging 1.00
R1413:Wfs1 UTSW 5 36982078 missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 36967015 missense probably damaging 0.99
R2009:Wfs1 UTSW 5 36968309 missense probably damaging 0.96
R2137:Wfs1 UTSW 5 36967501 missense probably damaging 0.99
R2157:Wfs1 UTSW 5 36967942 missense probably damaging 1.00
R2216:Wfs1 UTSW 5 36967220 nonsense probably null
R3779:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3853:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3918:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R4093:Wfs1 UTSW 5 36967465 missense probably damaging 0.97
R5056:Wfs1 UTSW 5 36975587 missense probably benign 0.00
R5849:Wfs1 UTSW 5 36973264 missense probably damaging 1.00
R5997:Wfs1 UTSW 5 36967750 missense probably damaging 0.99
R6666:Wfs1 UTSW 5 36967619 missense possibly damaging 0.94
R7024:Wfs1 UTSW 5 36966950 missense probably damaging 1.00
R7157:Wfs1 UTSW 5 36967172 missense probably benign 0.00
R7264:Wfs1 UTSW 5 36967846 missense probably damaging 1.00
R7269:Wfs1 UTSW 5 36967790 nonsense probably null
R7365:Wfs1 UTSW 5 36967732 missense probably benign 0.33
R7657:Wfs1 UTSW 5 36968234 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTACGGAAGTTCTCCCAGG -3'
(R):5'- ACGGATCTGTTAGGATGAGGCC -3'

Sequencing Primer
(F):5'- TGCTGTCCTGGAACACCTTGAG -3'
(R):5'- CTGTTAGGATGAGGCCCAGGAG -3'
Posted On2015-04-06