Incidental Mutation 'R3900:Timp2'
ID308949
Institutional Source Beutler Lab
Gene Symbol Timp2
Ensembl Gene ENSMUSG00000017466
Gene Nametissue inhibitor of metalloproteinase 2
SynonymsTimp-2, D11Bwg1104e, TIMP-2
MMRRC Submission 041607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3900 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118301069-118355740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118303716 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 139 (D139N)
Ref Sequence ENSEMBL: ENSMUSP00000122642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017610] [ENSMUST00000155707]
Predicted Effect probably damaging
Transcript: ENSMUST00000017610
AA Change: D216N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017610
Gene: ENSMUSG00000017466
AA Change: D216N

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
NTR 27 203 1.05e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155707
AA Change: D139N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122642
Gene: ENSMUSG00000017466
AA Change: D139N

DomainStartEndE-ValueType
NTR 1 126 1.48e-71 SMART
Meta Mutation Damage Score 0.1214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired activation of pro-matrix metalloproteinase-2, but appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Timp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2508:Timp2 UTSW 11 118310586 missense probably damaging 1.00
R3899:Timp2 UTSW 11 118303716 missense probably damaging 0.99
R4366:Timp2 UTSW 11 118310671 missense probably damaging 0.99
R4632:Timp2 UTSW 11 118303772 missense probably benign 0.00
R5496:Timp2 UTSW 11 118303881 missense probably benign 0.00
R5609:Timp2 UTSW 11 118320161 missense probably damaging 1.00
R5646:Timp2 UTSW 11 118317532 splice site probably null
R7733:Timp2 UTSW 11 118317529 critical splice acceptor site probably null
R7737:Timp2 UTSW 11 118303895 missense probably damaging 1.00
R7808:Timp2 UTSW 11 118303800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCACTACCATGTCTAGG -3'
(R):5'- ACTAAACCTTCCTGCATGTGTC -3'

Sequencing Primer
(F):5'- CCACTACCATGTCTAGGGAAAATAGG -3'
(R):5'- AGATCACTCGCTGTCCCATG -3'
Posted On2015-04-17