Incidental Mutation 'R3900:Gm10608'
ID308942
Institutional Source Beutler Lab
Gene Symbol Gm10608
Ensembl Gene ENSMUSG00000074029
Gene Namepredicted gene 10608
SynonymsEG546165
MMRRC Submission 041607-MU
Accession Numbers

Genbank: XR_031269; Ensembl: ENSMUST00000093527; MGI: 3642009

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3900 (G1)
Quality Score142
Status Not validated
Chromosome9
Chromosomal Location119162652-119164087 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA at 119160716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000093527]
Predicted Effect probably benign
Transcript: ENSMUST00000010795
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093527
SMART Domains Protein: ENSMUSP00000091246
Gene: ENSMUSG00000074029

DomainStartEndE-ValueType
Pfam:DUF3915 11 80 3.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213924
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,968 S212R probably damaging Het
AI182371 T C 2: 35,085,216 I334V probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Apc2 C A 10: 80,295,972 probably null Het
Bcl6 T G 16: 23,977,554 E41A possibly damaging Het
Brpf1 A G 6: 113,318,433 I674V probably benign Het
Cherp A G 8: 72,469,936 I201T possibly damaging Het
Cluh A G 11: 74,667,104 H1056R probably benign Het
Csgalnact2 A T 6: 118,121,014 F122I probably damaging Het
Cubn C A 2: 13,286,980 probably null Het
Dnah17 A T 11: 118,094,808 I1481N possibly damaging Het
Eif2ak4 A G 2: 118,475,029 Y1561C probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Eml5 G A 12: 98,825,523 R1245C probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Gm6133 A G 18: 78,350,150 N120D probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf9 T C 1: 172,489,558 L35P probably damaging Het
Khdc3 T C 9: 73,104,346 probably benign Het
Mmrn2 G T 14: 34,399,560 probably null Het
Mrgpra1 G T 7: 47,335,527 R135S possibly damaging Het
Olfr1201 A T 2: 88,794,929 L182F possibly damaging Het
Olfr971 A G 9: 39,839,402 probably null Het
Otud3 T C 4: 138,896,885 N282S probably benign Het
Prkar1a A G 11: 109,661,075 K130R probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Rictor T G 15: 6,789,473 D1392E probably benign Het
Setd2 C T 9: 110,592,518 R273W probably damaging Het
Slc22a18 C A 7: 143,479,770 A86E probably damaging Het
Slc24a1 A T 9: 64,928,144 S900R probably damaging Het
Smarcc1 T C 9: 110,118,518 probably benign Het
Smoc1 T C 12: 81,167,513 V234A probably damaging Het
Stard9 A G 2: 120,713,549 T4443A possibly damaging Het
Timp2 C T 11: 118,303,716 D139N probably damaging Het
Trim69 A G 2: 122,178,841 T461A probably benign Het
Ubash3b C T 9: 41,031,564 D211N probably benign Het
Ubr4 T C 4: 139,479,062 probably null Het
Ubr5 T C 15: 38,019,242 D752G probably damaging Het
Urb1 A T 16: 90,783,376 I633N possibly damaging Het
Usp36 T A 11: 118,279,824 D28V possibly damaging Het
Wdr6 G A 9: 108,575,769 A305V probably damaging Het
Zfp248 T C 6: 118,429,566 N253S probably damaging Het
Other mutations in Gm10608
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Gm10608 UTSW 9 119161088 unclassified probably benign
R1023:Gm10608 UTSW 9 119160716 small deletion probably benign
R1053:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1167:Gm10608 UTSW 9 119160716 frame shift probably null
R1172:Gm10608 UTSW 9 119160716 frame shift probably null
R1211:Gm10608 UTSW 9 119160712 frame shift probably null
R1601:Gm10608 UTSW 9 119160716 frame shift probably null
R1743:Gm10608 UTSW 9 119160716 small deletion probably benign
R1766:Gm10608 UTSW 9 119160716 frame shift probably null
R1939:Gm10608 UTSW 9 119160716 frame shift probably null
R2016:Gm10608 UTSW 9 119160716 small deletion probably benign
R2127:Gm10608 UTSW 9 119160716 small deletion probably benign
R2217:Gm10608 UTSW 9 119160716 frame shift probably null
R2270:Gm10608 UTSW 9 119160716 frame shift probably null
R2372:Gm10608 UTSW 9 119160716 small deletion probably benign
R2844:Gm10608 UTSW 9 119160716 frame shift probably null
R2959:Gm10608 UTSW 9 119160716 frame shift probably null
R2968:Gm10608 UTSW 9 119160716 small deletion probably benign
R3084:Gm10608 UTSW 9 119160716 frame shift probably null
R3607:Gm10608 UTSW 9 119160716 small deletion probably benign
R3702:Gm10608 UTSW 9 119160716 frame shift probably null
R3779:Gm10608 UTSW 9 119160716 small deletion probably benign
R3839:Gm10608 UTSW 9 119160716 frame shift probably null
R3947:Gm10608 UTSW 9 119160662 small deletion probably benign
R4015:Gm10608 UTSW 9 119160716 frame shift probably null
R4024:Gm10608 UTSW 9 119160716 small deletion probably benign
R5346:Gm10608 UTSW 9 119160724 frame shift probably null
X0065:Gm10608 UTSW 9 119160863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATGTGACAGGTGCCACAAC -3'
(R):5'- GCCTCTTCATAGGTCACATGCC -3'

Sequencing Primer
(F):5'- AGGTGCCACAACAGGGC -3'
(R):5'- TCAGATGGCAAAGCTTCCTG -3'
Posted On2015-04-17