Incidental Mutation 'R4004:Ces1d'
ID311394
Institutional Source Beutler Lab
Gene Symbol Ces1d
Ensembl Gene ENSMUSG00000056973
Gene Namecarboxylesterase 1D
SynonymsTGH, Ces3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4004 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93166068-93197838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93178092 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 340 (F340Y)
Ref Sequence ENSEMBL: ENSMUSP00000034172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034172]
Predicted Effect probably benign
Transcript: ENSMUST00000034172
AA Change: F340Y

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034172
Gene: ENSMUSG00000056973
AA Change: F340Y

DomainStartEndE-ValueType
Pfam:COesterase 1 545 4.9e-169 PFAM
Pfam:Abhydrolase_3 136 256 8.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148340
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased blood lipids, improved glucose tolerance, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A C 7: 79,100,687 E1735D probably damaging Het
Ano2 A G 6: 126,013,279 R788G probably damaging Het
Atg9a T C 1: 75,186,451 Y335C probably damaging Het
BC067074 A G 13: 113,318,380 Q320R probably benign Het
Capn10 T A 1: 92,940,591 L260Q probably damaging Het
Ctbp2 C A 7: 132,991,773 R733L probably benign Het
Dgkd T C 1: 87,935,423 I64T possibly damaging Het
Dmxl2 T C 9: 54,446,390 I765V probably benign Het
Dync2h1 C A 9: 7,117,404 C62F probably damaging Het
F2 T C 2: 91,628,396 N523S possibly damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fcgr1 A G 3: 96,284,352 V380A probably benign Het
Gif T G 19: 11,759,007 V314G probably damaging Het
Herc2 C A 7: 56,106,465 P751Q possibly damaging Het
Ikzf3 C T 11: 98,489,017 E142K probably damaging Het
Kctd3 A G 1: 188,992,743 S214P probably benign Het
Lrpap1 T A 5: 35,105,544 K50* probably null Het
Naa11 A T 5: 97,391,793 Y169N probably benign Het
Nupl2 T C 5: 24,182,436 I408T probably damaging Het
Olfr366 A T 2: 37,219,948 H153L probably benign Het
Olfr721-ps1 C T 14: 14,408,152 A308V probably benign Het
Plxnc1 G A 10: 94,794,597 Q1512* probably null Het
Ptpn14 A G 1: 189,850,510 N518S probably benign Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Ric1 C T 19: 29,579,801 R429C probably benign Het
Rpn2 T C 2: 157,318,008 L548P probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Slc28a1 T C 7: 81,169,038 S580P probably damaging Het
Slco6c1 A G 1: 97,075,885 Y496H probably damaging Het
Spag5 T C 11: 78,321,529 M1101T probably benign Het
Utp11 A T 4: 124,682,437 F138I probably damaging Het
Vcp G A 4: 42,983,028 T606I probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp316 A G 5: 143,255,119 S382P possibly damaging Het
Other mutations in Ces1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Ces1d APN 8 93195089 splice site probably benign
IGL01707:Ces1d APN 8 93189550 missense possibly damaging 0.57
IGL01753:Ces1d APN 8 93192810 missense probably damaging 1.00
IGL01918:Ces1d APN 8 93178075 missense probably benign 0.00
IGL02730:Ces1d APN 8 93186016 missense probably benign
IGL02819:Ces1d APN 8 93169718 splice site probably null
IGL02824:Ces1d APN 8 93169718 splice site probably null
IGL02825:Ces1d APN 8 93169718 splice site probably null
IGL02858:Ces1d APN 8 93169718 splice site probably null
IGL02877:Ces1d APN 8 93169718 splice site probably null
IGL02946:Ces1d APN 8 93169718 splice site probably null
IGL02990:Ces1d APN 8 93169718 splice site probably null
IGL03024:Ces1d APN 8 93169718 splice site probably null
IGL03080:Ces1d APN 8 93169718 splice site probably null
IGL03081:Ces1d APN 8 93169718 splice site probably null
IGL03082:Ces1d APN 8 93169718 splice site probably null
IGL03096:Ces1d APN 8 93178042 missense probably benign 0.01
IGL03165:Ces1d APN 8 93189519 missense probably benign 0.02
IGL03233:Ces1d APN 8 93195079 missense probably benign
IGL03263:Ces1d APN 8 93169718 splice site probably null
IGL03310:Ces1d APN 8 93175188 splice site probably benign
IGL03338:Ces1d APN 8 93169718 splice site probably null
IGL03357:Ces1d APN 8 93169718 splice site probably null
R0125:Ces1d UTSW 8 93175182 splice site probably benign
R0393:Ces1d UTSW 8 93192772 missense probably damaging 1.00
R0483:Ces1d UTSW 8 93197679 missense probably benign
R0746:Ces1d UTSW 8 93189468 missense probably damaging 1.00
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1470:Ces1d UTSW 8 93195021 missense possibly damaging 0.50
R1607:Ces1d UTSW 8 93186118 missense probably benign 0.08
R1879:Ces1d UTSW 8 93189498 missense probably benign 0.35
R2881:Ces1d UTSW 8 93195031 missense probably damaging 1.00
R3870:Ces1d UTSW 8 93175086 missense probably benign 0.15
R4573:Ces1d UTSW 8 93181534 missense probably benign 0.00
R4647:Ces1d UTSW 8 93166410 missense probably damaging 1.00
R4985:Ces1d UTSW 8 93175144 missense possibly damaging 0.61
R5080:Ces1d UTSW 8 93181547 missense probably benign 0.02
R5209:Ces1d UTSW 8 93175188 splice site probably benign
R5351:Ces1d UTSW 8 93178078 missense probably damaging 1.00
R5433:Ces1d UTSW 8 93186036 missense probably benign 0.02
R5614:Ces1d UTSW 8 93176204 missense probably benign 0.00
R5722:Ces1d UTSW 8 93178128 missense probably benign 0.01
R6257:Ces1d UTSW 8 93166397 missense probably benign 0.03
R7238:Ces1d UTSW 8 93178135 missense probably benign 0.01
R7410:Ces1d UTSW 8 93192805 missense probably damaging 1.00
R7489:Ces1d UTSW 8 93178131 missense probably damaging 1.00
R7563:Ces1d UTSW 8 93178039 missense probably benign 0.25
R7827:Ces1d UTSW 8 93197666 critical splice donor site probably null
R7853:Ces1d UTSW 8 93175067 missense probably benign 0.29
R7860:Ces1d UTSW 8 93171137 missense probably benign 0.08
R7936:Ces1d UTSW 8 93175067 missense probably benign 0.29
R7943:Ces1d UTSW 8 93171137 missense probably benign 0.08
RF014:Ces1d UTSW 8 93176165 critical splice donor site probably null
Z1088:Ces1d UTSW 8 93175108 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAGCACTTCAAAAGGCTTC -3'
(R):5'- GGCTCTTTGTGCTGACCAAG -3'

Sequencing Primer
(F):5'- AAGGCTTCATCAAGGATTCTCC -3'
(R):5'- TGACCAAGCTTTCAGACATCCAGAG -3'
Posted On2015-04-29