Incidental Mutation 'R4013:Gm4846'
ID311799
Institutional Source Beutler Lab
Gene Symbol Gm4846
Ensembl Gene ENSMUSG00000086056
Gene Namepredicted gene 4846
Synonyms
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4013 (G1)
Quality Score194
Status Validated
Chromosome1
Chromosomal Location166483613-166497588 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 166494680 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143922] [ENSMUST00000143922]
Predicted Effect probably null
Transcript: ENSMUST00000143922
SMART Domains Protein: ENSMUSP00000123476
Gene: ENSMUSG00000086056

DomainStartEndE-ValueType
Pfam:FMO-like 3 534 9.2e-239 PFAM
Pfam:Pyr_redox_2 4 227 1.1e-10 PFAM
Pfam:Pyr_redox_3 7 221 1.9e-12 PFAM
Pfam:NAD_binding_8 8 92 4.2e-7 PFAM
Pfam:K_oxygenase 77 333 3.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143922
SMART Domains Protein: ENSMUSP00000123476
Gene: ENSMUSG00000086056

DomainStartEndE-ValueType
Pfam:FMO-like 3 534 9.2e-239 PFAM
Pfam:Pyr_redox_2 4 227 1.1e-10 PFAM
Pfam:Pyr_redox_3 7 221 1.9e-12 PFAM
Pfam:NAD_binding_8 8 92 4.2e-7 PFAM
Pfam:K_oxygenase 77 333 3.4e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp3a59 A G 5: 146,079,383 T17A probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Cysltr2 A G 14: 73,029,565 I235T probably damaging Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Igsf21 T C 4: 140,037,469 N165S possibly damaging Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrrc63 A G 14: 75,098,291 Y460H probably damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r52 G A 7: 10,170,676 T412I probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Gm4846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02682:Gm4846 APN 1 166494626 missense probably damaging 1.00
IGL02975:Gm4846 APN 1 166483880 missense possibly damaging 0.46
R0504:Gm4846 UTSW 1 166491545 missense probably benign 0.04
R0989:Gm4846 UTSW 1 166487120 missense possibly damaging 0.81
R1836:Gm4846 UTSW 1 166483923 missense probably benign 0.17
R1965:Gm4846 UTSW 1 166486964 missense possibly damaging 0.93
R3120:Gm4846 UTSW 1 166491548 missense probably benign 0.11
R4617:Gm4846 UTSW 1 166495981 missense probably damaging 1.00
R4641:Gm4846 UTSW 1 166483893 missense probably damaging 0.99
R4825:Gm4846 UTSW 1 166491668 missense probably damaging 1.00
R4952:Gm4846 UTSW 1 166483934 missense probably damaging 0.97
R5135:Gm4846 UTSW 1 166483982 missense probably damaging 1.00
R5230:Gm4846 UTSW 1 166490179 missense probably benign 0.26
R5335:Gm4846 UTSW 1 166497453 nonsense probably null
R5711:Gm4846 UTSW 1 166484025 missense probably benign 0.12
R5957:Gm4846 UTSW 1 166486953 missense probably benign
R6024:Gm4846 UTSW 1 166490127 missense probably benign 0.00
R6460:Gm4846 UTSW 1 166497513 missense probably benign 0.00
R6764:Gm4846 UTSW 1 166491552 missense probably benign
R6833:Gm4846 UTSW 1 166494578 missense possibly damaging 0.63
R6834:Gm4846 UTSW 1 166494578 missense possibly damaging 0.63
R7161:Gm4846 UTSW 1 166487010 missense probably damaging 1.00
R7275:Gm4846 UTSW 1 166487079 missense probably benign 0.01
R7622:Gm4846 UTSW 1 166495872 missense possibly damaging 0.64
R7890:Gm4846 UTSW 1 166494659 missense probably benign
R7973:Gm4846 UTSW 1 166494659 missense probably benign
R8072:Gm4846 UTSW 1 166494672 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTGTGGTTCATTCAGTTAAATACC -3'
(R):5'- GCAACTTTTGGGATAGCATTGG -3'

Sequencing Primer
(F):5'- TCAGTTAAATACCTGCAAAATCCTGC -3'
(R):5'- GTGGAGGTAACAACTTGGTT -3'
Posted On2015-04-29