Incidental Mutation 'R4013:Igsf21'
ID311810
Institutional Source Beutler Lab
Gene Symbol Igsf21
Ensembl Gene ENSMUSG00000040972
Gene Nameimmunoglobulin superfamily, member 21
SynonymsLOC230868
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4013 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location140026846-140246784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140037469 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 165 (N165S)
Ref Sequence ENSEMBL: ENSMUSP00000046558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039331
AA Change: N165S

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046558
Gene: ENSMUSG00000040972
AA Change: N165S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 141 1.93e-5 SMART
IG 348 431 2.38e0 SMART
Meta Mutation Damage Score 0.1909 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which has two immunoglobulin (Ig) domains and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal differentiation of inhibitory synapses with decreased mIPSC frequency and prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp3a59 A G 5: 146,079,383 T17A probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Cysltr2 A G 14: 73,029,565 I235T probably damaging Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Gm4846 A C 1: 166,494,680 probably null Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrrc63 A G 14: 75,098,291 Y460H probably damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r52 G A 7: 10,170,676 T412I probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Igsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Igsf21 APN 4 140027718 splice site probably benign
IGL01613:Igsf21 APN 4 140107364 missense possibly damaging 0.75
IGL01618:Igsf21 APN 4 140107364 missense possibly damaging 0.75
R1458:Igsf21 UTSW 4 140028124 missense probably damaging 1.00
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1464:Igsf21 UTSW 4 140034525 missense probably benign
R1793:Igsf21 UTSW 4 140034392 missense probably damaging 1.00
R1913:Igsf21 UTSW 4 140107312 missense probably benign
R2220:Igsf21 UTSW 4 140028114 missense probably damaging 1.00
R4721:Igsf21 UTSW 4 140107310 missense probably benign 0.09
R4911:Igsf21 UTSW 4 140034623 missense probably benign 0.01
R5157:Igsf21 UTSW 4 140028067 missense possibly damaging 0.53
R5725:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R5778:Igsf21 UTSW 4 140037521 missense probably benign 0.28
R5804:Igsf21 UTSW 4 140028074 missense possibly damaging 0.70
R6140:Igsf21 UTSW 4 140107373 missense probably benign 0.10
R6778:Igsf21 UTSW 4 140034648 missense probably benign 0.05
R6888:Igsf21 UTSW 4 140034743 missense probably benign 0.02
R6963:Igsf21 UTSW 4 140027730 missense probably benign 0.02
R7203:Igsf21 UTSW 4 140107337 missense possibly damaging 0.70
R7485:Igsf21 UTSW 4 140027738 missense probably benign 0.09
R7880:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
R7963:Igsf21 UTSW 4 140157508 missense probably damaging 1.00
Z1176:Igsf21 UTSW 4 140067215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACTCCTGGAAGTCAACC -3'
(R):5'- AAGCAGGGACTCTTGTGTCTC -3'

Sequencing Primer
(F):5'- ACCTTACTATGCCGATCTAGGATGG -3'
(R):5'- GGACTCTTGTGTCTCCAGCAAG -3'
Posted On2015-04-29