Incidental Mutation 'R5957:Gm4846'
ID471213
Institutional Source Beutler Lab
Gene Symbol Gm4846
Ensembl Gene ENSMUSG00000086056
Gene Namepredicted gene 4846
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location166483613-166497588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166486953 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 374 (I374V)
Ref Sequence ENSEMBL: ENSMUSP00000123476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143922]
Predicted Effect probably benign
Transcript: ENSMUST00000143922
AA Change: I374V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123476
Gene: ENSMUSG00000086056
AA Change: I374V

DomainStartEndE-ValueType
Pfam:FMO-like 3 534 9.2e-239 PFAM
Pfam:Pyr_redox_2 4 227 1.1e-10 PFAM
Pfam:Pyr_redox_3 7 221 1.9e-12 PFAM
Pfam:NAD_binding_8 8 92 4.2e-7 PFAM
Pfam:K_oxygenase 77 333 3.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Gm4846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02682:Gm4846 APN 1 166494626 missense probably damaging 1.00
IGL02975:Gm4846 APN 1 166483880 missense possibly damaging 0.46
R0504:Gm4846 UTSW 1 166491545 missense probably benign 0.04
R0989:Gm4846 UTSW 1 166487120 missense possibly damaging 0.81
R1836:Gm4846 UTSW 1 166483923 missense probably benign 0.17
R1965:Gm4846 UTSW 1 166486964 missense possibly damaging 0.93
R3120:Gm4846 UTSW 1 166491548 missense probably benign 0.11
R4013:Gm4846 UTSW 1 166494680 splice site probably null
R4617:Gm4846 UTSW 1 166495981 missense probably damaging 1.00
R4641:Gm4846 UTSW 1 166483893 missense probably damaging 0.99
R4825:Gm4846 UTSW 1 166491668 missense probably damaging 1.00
R4952:Gm4846 UTSW 1 166483934 missense probably damaging 0.97
R5135:Gm4846 UTSW 1 166483982 missense probably damaging 1.00
R5230:Gm4846 UTSW 1 166490179 missense probably benign 0.26
R5335:Gm4846 UTSW 1 166497453 nonsense probably null
R5711:Gm4846 UTSW 1 166484025 missense probably benign 0.12
R6024:Gm4846 UTSW 1 166490127 missense probably benign 0.00
R6460:Gm4846 UTSW 1 166497513 missense probably benign 0.00
R6764:Gm4846 UTSW 1 166491552 missense probably benign
R6833:Gm4846 UTSW 1 166494578 missense possibly damaging 0.63
R6834:Gm4846 UTSW 1 166494578 missense possibly damaging 0.63
R7161:Gm4846 UTSW 1 166487010 missense probably damaging 1.00
R7275:Gm4846 UTSW 1 166487079 missense probably benign 0.01
R7622:Gm4846 UTSW 1 166495872 missense possibly damaging 0.64
R7890:Gm4846 UTSW 1 166494659 missense probably benign
R8072:Gm4846 UTSW 1 166494672 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCTACACCTCTGCCTTAGC -3'
(R):5'- CATTTCCGGAAGAGTGCTGGTG -3'

Sequencing Primer
(F):5'- GCCTTAGCAGAATAGGTAACATTAG -3'
(R):5'- ACGTCCGCCATCTTTGAGGATG -3'
Posted On2017-03-31