Incidental Mutation 'R4013:Lrrc63'
ID311834
Institutional Source Beutler Lab
Gene Symbol Lrrc63
Ensembl Gene ENSMUSG00000021997
Gene Nameleucine rich repeat containing 63
Synonyms4921509B22Rik
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4013 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75084303-75130881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75098291 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 460 (Y460H)
Ref Sequence ENSEMBL: ENSMUSP00000022574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022574]
Predicted Effect probably damaging
Transcript: ENSMUST00000022574
AA Change: Y460H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022574
Gene: ENSMUSG00000021997
AA Change: Y460H

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 276 310 N/A INTRINSIC
LRR 412 434 2.82e0 SMART
LRR 435 458 1.45e1 SMART
LRR 481 504 1.53e-1 SMART
Meta Mutation Damage Score 0.1888 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp3a59 A G 5: 146,079,383 T17A probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Cysltr2 A G 14: 73,029,565 I235T probably damaging Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Gm4846 A C 1: 166,494,680 probably null Het
Igsf21 T C 4: 140,037,469 N165S possibly damaging Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r52 G A 7: 10,170,676 T412I probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Lrrc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Lrrc63 APN 14 75084982 missense possibly damaging 0.73
IGL02222:Lrrc63 APN 14 75086140 missense probably damaging 0.99
IGL02385:Lrrc63 APN 14 75086200 missense probably benign
FR4548:Lrrc63 UTSW 14 75125182 small deletion probably benign
FR4589:Lrrc63 UTSW 14 75125182 small deletion probably benign
R0398:Lrrc63 UTSW 14 75126470 missense probably benign 0.06
R0637:Lrrc63 UTSW 14 75098220 splice site probably benign
R0669:Lrrc63 UTSW 14 75126110 missense probably benign 0.27
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1478:Lrrc63 UTSW 14 75125984 missense probably benign
R1591:Lrrc63 UTSW 14 75125892 missense possibly damaging 0.92
R1753:Lrrc63 UTSW 14 75086344 splice site probably null
R3713:Lrrc63 UTSW 14 75107336 missense probably benign 0.12
R4793:Lrrc63 UTSW 14 75126161 missense possibly damaging 0.93
R4888:Lrrc63 UTSW 14 75125966 missense probably benign
R4937:Lrrc63 UTSW 14 75084949 missense probably damaging 0.99
R5197:Lrrc63 UTSW 14 75084882 missense possibly damaging 0.68
R5747:Lrrc63 UTSW 14 75126464 missense probably benign
R5861:Lrrc63 UTSW 14 75107366 missense possibly damaging 0.83
R5905:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6028:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6661:Lrrc63 UTSW 14 75125193 missense unknown
R6982:Lrrc63 UTSW 14 75084771 missense probably benign 0.33
R7062:Lrrc63 UTSW 14 75086297 missense probably benign 0.00
R7439:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7440:Lrrc63 UTSW 14 75121013 missense possibly damaging 0.91
R7441:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7474:Lrrc63 UTSW 14 75126203 missense possibly damaging 0.83
R7604:Lrrc63 UTSW 14 75084969 missense possibly damaging 0.68
R7703:Lrrc63 UTSW 14 75123007 missense possibly damaging 0.91
R7819:Lrrc63 UTSW 14 75125221 small insertion probably benign
Z1088:Lrrc63 UTSW 14 75125990 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACAGGTGAATTCAAGGCTTTTG -3'
(R):5'- AGCAGCACCGTTTTCAGAAG -3'

Sequencing Primer
(F):5'- AAAAGAACTTGACTCTGTGTGTGTG -3'
(R):5'- CAGCACCGTTTTCAGAAGTGTTTG -3'
Posted On2015-04-29