Incidental Mutation 'R4125:Tnpo3'
ID315351
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Nametransportin 3
SynonymsD6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission 041633-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4125 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29540827-29609887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29560092 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 684 (L684P)
Ref Sequence ENSEMBL: ENSMUSP00000110906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
Predicted Effect probably damaging
Transcript: ENSMUST00000012679
AA Change: L684P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: L684P

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115251
AA Change: L684P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: L684P

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169302
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Predicted Effect unknown
Transcript: ENSMUST00000170647
AA Change: L1P
SMART Domains Protein: ENSMUSP00000133115
Gene: ENSMUSG00000012535
AA Change: L1P

DomainStartEndE-ValueType
SCOP:d1qbkb_ 2 187 1e-5 SMART
PDB:4C0P|D 2 247 1e-156 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171865
Meta Mutation Damage Score 0.8608 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 T A 3: 98,161,363 C43S probably damaging Het
Adamts6 A T 13: 104,312,904 Y274F probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Atm A C 9: 53,450,621 L2732R probably damaging Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Bmpr1a T C 14: 34,434,733 D112G probably benign Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Chuk T C 19: 44,100,174 I121V probably null Het
Ctsr A T 13: 61,161,845 D183E probably benign Het
Elp3 T C 14: 65,560,181 E347G possibly damaging Het
Fam160a1 A G 3: 85,665,383 S988P possibly damaging Het
Gm13078 C T 4: 143,726,280 R94* probably null Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Gramd3 T C 18: 56,485,224 S199P probably damaging Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Ifit1bl1 T A 19: 34,594,788 I90F probably damaging Het
Igf2r A T 17: 12,702,254 H1313Q possibly damaging Het
Ighj4 T C 12: 113,428,556 probably benign Het
Kansl2 G T 15: 98,531,755 P132Q possibly damaging Het
Lman1 T C 18: 65,987,861 H430R possibly damaging Het
Lrrk2 T C 15: 91,815,483 I2511T probably benign Het
Lvrn C A 18: 46,876,969 P395T possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Nectin4 A G 1: 171,385,733 S408G probably benign Het
Olfr629 T C 7: 103,741,000 K80R probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pcdhb13 T C 18: 37,443,820 I417T probably damaging Het
Per2 T C 1: 91,429,450 T664A possibly damaging Het
Plec A T 15: 76,172,762 L4347Q probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Polr1a T C 6: 71,965,706 F1177L probably benign Het
Ptprb A T 10: 116,353,849 R1804S probably benign Het
Rhof C T 5: 123,119,525 V181M probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc22a12 T C 19: 6,538,788 E281G probably damaging Het
Slco6b1 T A 1: 96,987,897 noncoding transcript Het
Stac C A 9: 111,604,058 probably null Het
Tcof1 C A 18: 60,819,601 A898S unknown Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Thoc6 A T 17: 23,669,345 probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Umps G A 16: 33,956,918 Q431* probably null Het
Unc13c A G 9: 73,574,007 probably null Het
Vmn1r210 A T 13: 22,827,609 M169K probably benign Het
Zfp946 C T 17: 22,454,567 Q101* probably null Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0384:Tnpo3 UTSW 6 29582164 critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29565759 missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29562900 nonsense probably null
R7898:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7901:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R7981:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7984:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R8003:Tnpo3 UTSW 6 29551901 missense probably benign 0.09
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACACTACTTCTATACAGGCTG -3'
(R):5'- GCTGAATCAGGCCATGTGTAC -3'

Sequencing Primer
(F):5'- GACTTCATTTCACCAGCAA -3'
(R):5'- TGCTGTAATCCCAGTAACTCAGGAG -3'
Posted On2015-05-14