Incidental Mutation 'R4172:Tpm1'
ID318181
Institutional Source Beutler Lab
Gene Symbol Tpm1
Ensembl Gene ENSMUSG00000032366
Gene Nametropomyosin 1, alpha
SynonymsTM2, Tpm-1, alpha-TM, Tm3
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67022590-67049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67023367 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 283 (N283D)
Ref Sequence ENSEMBL: ENSMUSP00000109331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034928] [ENSMUST00000050905] [ENSMUST00000113684] [ENSMUST00000113685] [ENSMUST00000113686] [ENSMUST00000113687] [ENSMUST00000113689] [ENSMUST00000113690] [ENSMUST00000113693] [ENSMUST00000113695] [ENSMUST00000113696] [ENSMUST00000113697] [ENSMUST00000113701] [ENSMUST00000113705] [ENSMUST00000113707] [ENSMUST00000129733] [ENSMUST00000139046]
Predicted Effect probably benign
Transcript: ENSMUST00000034928
AA Change: N325D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034928
Gene: ENSMUSG00000032366
AA Change: N325D

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:Tropomyosin_1 56 195 4.1e-29 PFAM
Pfam:Tropomyosin 90 326 5.9e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050905
SMART Domains Protein: ENSMUSP00000051888
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 5.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113684
SMART Domains Protein: ENSMUSP00000109314
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 248 8.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113685
SMART Domains Protein: ENSMUSP00000109315
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 3.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113686
SMART Domains Protein: ENSMUSP00000109316
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 2.9e-23 PFAM
Pfam:Tropomyosin 12 228 8.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113687
SMART Domains Protein: ENSMUSP00000109317
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.4e-40 PFAM
Pfam:Tropomyosin 48 264 1.8e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113689
SMART Domains Protein: ENSMUSP00000109319
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 244 8.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113690
SMART Domains Protein: ENSMUSP00000109320
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 5.9e-23 PFAM
Pfam:Tropomyosin 12 244 8.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113693
SMART Domains Protein: ENSMUSP00000109323
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.1e-37 PFAM
Pfam:Tropomyosin 48 280 8.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113695
AA Change: N247D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109325
Gene: ENSMUSG00000032366
AA Change: N247D

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113696
AA Change: N247D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109326
Gene: ENSMUSG00000032366
AA Change: N247D

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 2.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113697
AA Change: N283D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109327
Gene: ENSMUSG00000032366
AA Change: N283D

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113701
AA Change: N283D

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109331
Gene: ENSMUSG00000032366
AA Change: N283D

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 1.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113705
AA Change: N283D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109335
Gene: ENSMUSG00000032366
AA Change: N283D

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 9.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113707
AA Change: N283D

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109337
Gene: ENSMUSG00000032366
AA Change: N283D

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129733
SMART Domains Protein: ENSMUSP00000138784
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 4e-36 PFAM
Pfam:Tropomyosin 48 128 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Tpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01288:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01569:Tpm1 APN 9 67031108 splice site probably null
R1137:Tpm1 UTSW 9 67031118 intron probably null
R1554:Tpm1 UTSW 9 67023429 missense probably benign 0.04
R2012:Tpm1 UTSW 9 67033965 nonsense probably null
R2898:Tpm1 UTSW 9 67031040 missense probably damaging 1.00
R3723:Tpm1 UTSW 9 67031945 intron probably benign
R3724:Tpm1 UTSW 9 67031945 intron probably benign
R4427:Tpm1 UTSW 9 67032565 intron probably benign
R4934:Tpm1 UTSW 9 67028049 splice site probably null
R5605:Tpm1 UTSW 9 67049035 missense probably damaging 0.99
R5726:Tpm1 UTSW 9 67023412 missense probably damaging 0.97
R6556:Tpm1 UTSW 9 67028169 critical splice acceptor site probably null
R6910:Tpm1 UTSW 9 67031974 missense probably damaging 1.00
R7242:Tpm1 UTSW 9 67028101 missense probably benign
R7386:Tpm1 UTSW 9 67028167 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAACAAGTGCCCTGACTCGG -3'
(R):5'- TGTAGTGCCACTCATCTGTGTG -3'

Sequencing Primer
(F):5'- GACTCGGGCTTGCCTTTCTG -3'
(R):5'- ACTCATCTGTGTGTGACTGG -3'
Posted On2015-06-10