Incidental Mutation 'R4180:Klf17'
ID 319681
Institutional Source Beutler Lab
Gene Symbol Klf17
Ensembl Gene ENSMUSG00000048626
Gene Name Kruppel-like factor 17
Synonyms D4Ertd561e, 7420700M05Rik, Zfp393
MMRRC Submission 041016-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4180 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 117757836-117765648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117759186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 316 (H316L)
Ref Sequence ENSEMBL: ENSMUSP00000052316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062747]
AlphaFold Q8CFA7
Predicted Effect probably benign
Transcript: ENSMUST00000062747
AA Change: H316L

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052316
Gene: ENSMUSG00000048626
AA Change: H316L

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
ZnF_C2H2 256 280 4.47e-3 SMART
ZnF_C2H2 286 310 1.92e-2 SMART
ZnF_C2H2 316 338 1.1e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,441,578 S1326P possibly damaging Het
Adam22 T G 5: 8,149,218 D246A probably damaging Het
Bmf T C 2: 118,532,537 probably benign Het
Cd300lf T C 11: 115,124,263 Y160C possibly damaging Het
Chuk G A 19: 44,101,840 A71V probably benign Het
Col19a1 C T 1: 24,270,392 G1060E probably damaging Het
Dock7 A G 4: 99,016,736 V634A probably benign Het
Dpm3 A G 3: 89,266,732 probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fam184b T C 5: 45,539,764 E686G probably benign Het
Fhad1 T A 4: 141,985,543 D195V possibly damaging Het
Glis2 T C 16: 4,611,376 S148P probably benign Het
Gm8587 C T 12: 88,089,746 noncoding transcript Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Haus6 A T 4: 86,583,574 W687R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Ints9 T C 14: 64,992,981 L119P probably damaging Het
Itga9 T C 9: 118,607,078 Y51H probably damaging Het
Klf4 C T 4: 55,530,884 G26R possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lhcgr A G 17: 88,742,283 V605A probably damaging Het
Mafa T C 15: 75,747,564 Y120C possibly damaging Het
Map3k20 A G 2: 72,441,571 Y681C probably damaging Het
Nub1 T C 5: 24,692,877 I87T probably damaging Het
Olfr356 T A 2: 36,937,230 V37D probably damaging Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pdzrn4 T A 15: 92,402,017 V256D possibly damaging Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkcd A G 14: 30,610,304 probably benign Het
Rgcc T C 14: 79,300,715 S79G probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Stxbp5l A T 16: 37,247,880 C315S probably benign Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tcerg1l T C 7: 138,276,676 probably null Het
Tex12 T C 9: 50,559,287 probably null Het
Tgm5 T C 2: 121,076,961 I94V probably benign Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trbv4 A C 6: 41,059,712 D57A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tuba4a T C 1: 75,215,782 D396G probably benign Het
Txnrd2 C G 16: 18,426,425 probably null Het
Zfp445 T C 9: 122,852,524 N784S probably benign Het
Zfp459 G T 13: 67,408,443 L174I probably benign Het
Other mutations in Klf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Klf17 APN 4 117761038 missense probably benign 0.06
IGL01399:Klf17 APN 4 117759159 missense probably damaging 1.00
R0047:Klf17 UTSW 4 117761032 missense probably benign 0.00
R0051:Klf17 UTSW 4 117760392 missense probably damaging 1.00
R0051:Klf17 UTSW 4 117760392 missense probably damaging 1.00
R1513:Klf17 UTSW 4 117760935 missense probably damaging 0.96
R3103:Klf17 UTSW 4 117760608 missense possibly damaging 0.72
R4112:Klf17 UTSW 4 117760701 missense possibly damaging 0.85
R4669:Klf17 UTSW 4 117760371 missense probably damaging 1.00
R4715:Klf17 UTSW 4 117760536 missense probably benign 0.44
R5063:Klf17 UTSW 4 117760659 missense possibly damaging 0.85
R7578:Klf17 UTSW 4 117760719 missense possibly damaging 0.85
R7765:Klf17 UTSW 4 117760615 missense probably benign 0.08
R9041:Klf17 UTSW 4 117760359 missense probably damaging 1.00
Z1176:Klf17 UTSW 4 117760351 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGATCTGGTCTTGAGCAACTG -3'
(R):5'- ATCTAGGGGCCTTTACCTCC -3'

Sequencing Primer
(F):5'- CTGAATCTTGGGTTAGAGACTACAG -3'
(R):5'- GGGGCCTTTACCTCCCACTG -3'
Posted On 2015-06-10