Incidental Mutation 'R3103:Klf17'
ID 262890
Institutional Source Beutler Lab
Gene Symbol Klf17
Ensembl Gene ENSMUSG00000048626
Gene Name Kruppel-like factor 17
Synonyms D4Ertd561e, 7420700M05Rik, Zfp393
MMRRC Submission 040577-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3103 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 117757836-117765648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117760608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 184 (Q184L)
Ref Sequence ENSEMBL: ENSMUSP00000052316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062747]
AlphaFold Q8CFA7
Predicted Effect possibly damaging
Transcript: ENSMUST00000062747
AA Change: Q184L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052316
Gene: ENSMUSG00000048626
AA Change: Q184L

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
ZnF_C2H2 256 280 4.47e-3 SMART
ZnF_C2H2 286 310 1.92e-2 SMART
ZnF_C2H2 316 338 1.1e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 A G 7: 28,610,984 probably null Het
Adap2 G T 11: 80,157,033 C105F probably damaging Het
Bace2 T C 16: 97,422,001 probably null Het
Bpifc A G 10: 85,993,422 S94P probably damaging Het
C2cd3 A G 7: 100,395,252 D347G possibly damaging Het
Cad T C 5: 31,061,674 V613A possibly damaging Het
Ccdc47 T C 11: 106,202,841 H6R probably benign Het
Celsr3 A G 9: 108,837,139 T1956A probably benign Het
Cep128 T A 12: 91,019,344 D1006V probably damaging Het
Cog3 T C 14: 75,747,201 probably null Het
Csmd1 C T 8: 15,917,405 V3153M probably damaging Het
Ctnna2 T C 6: 77,653,144 E122G possibly damaging Het
Cts8 T A 13: 61,250,958 I245F probably damaging Het
Ddx27 T A 2: 167,026,246 V333E probably damaging Het
Dmpk A G 7: 19,087,654 Y279C probably damaging Het
Dpagt1 A G 9: 44,327,995 I111V probably benign Het
Dvl2 C A 11: 70,008,869 P546T possibly damaging Het
Fat4 G T 3: 38,891,940 A1661S probably benign Het
Gcm1 A G 9: 78,064,452 N225S probably damaging Het
Gcnt2 A T 13: 40,918,606 M242L probably benign Het
Golgb1 A G 16: 36,894,849 R226G probably damaging Het
Gpr63 G A 4: 25,007,353 V26I probably benign Het
Grik2 A G 10: 49,240,772 L631P probably damaging Het
Hapln3 T C 7: 79,121,736 D135G probably benign Het
Il31ra C A 13: 112,530,351 V398F probably damaging Het
Ipp G T 4: 116,524,249 R315L possibly damaging Het
Kcmf1 A G 6: 72,861,847 L32P probably damaging Het
Lrp2 C T 2: 69,431,984 V4442I probably benign Het
Lrrfip2 A T 9: 111,222,210 E293D probably damaging Het
Oit3 A G 10: 59,438,891 I29T probably damaging Het
Olfr403 G A 11: 74,196,075 D191N probably benign Het
Olfr50 T C 2: 36,793,562 C109R possibly damaging Het
Olfr555 T C 7: 102,659,481 V220A probably benign Het
Plb1 T A 5: 32,328,029 M842K possibly damaging Het
Ppt1 T C 4: 122,836,307 C18R probably benign Het
Pstpip2 T C 18: 77,871,777 Y191H probably damaging Het
Ryr1 C T 7: 29,074,948 V2361I probably damaging Het
Serpinb11 A G 1: 107,377,608 N238S probably benign Het
Skor2 A T 18: 76,859,278 K232* probably null Het
Slc13a5 A T 11: 72,257,388 W231R probably damaging Het
Svs5 A T 2: 164,333,393 E55V probably benign Het
Tfcp2 A T 15: 100,525,600 W142R probably damaging Het
Trpc2 A T 7: 102,095,234 I738F possibly damaging Het
Vmn2r61 T A 7: 42,266,643 S227T possibly damaging Het
Zfhx4 A G 3: 5,399,326 T1540A probably damaging Het
Zfp616 A G 11: 74,071,735 T74A probably benign Het
Other mutations in Klf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Klf17 APN 4 117761038 missense probably benign 0.06
IGL01399:Klf17 APN 4 117759159 missense probably damaging 1.00
R0047:Klf17 UTSW 4 117761032 missense probably benign 0.00
R0051:Klf17 UTSW 4 117760392 missense probably damaging 1.00
R0051:Klf17 UTSW 4 117760392 missense probably damaging 1.00
R1513:Klf17 UTSW 4 117760935 missense probably damaging 0.96
R4112:Klf17 UTSW 4 117760701 missense possibly damaging 0.85
R4180:Klf17 UTSW 4 117759186 missense probably benign 0.14
R4669:Klf17 UTSW 4 117760371 missense probably damaging 1.00
R4715:Klf17 UTSW 4 117760536 missense probably benign 0.44
R5063:Klf17 UTSW 4 117760659 missense possibly damaging 0.85
R7578:Klf17 UTSW 4 117760719 missense possibly damaging 0.85
R7765:Klf17 UTSW 4 117760615 missense probably benign 0.08
R9041:Klf17 UTSW 4 117760359 missense probably damaging 1.00
Z1176:Klf17 UTSW 4 117760351 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGCCCCTCTTGAAGTACTGG -3'
(R):5'- GGGAGTGACCATTTCCTTCAGTG -3'

Sequencing Primer
(F):5'- CCTCTTGAAGTACTGGGGCTC -3'
(R):5'- AATCTAATGCCTCAGGGTGGC -3'
Posted On 2015-02-05