Incidental Mutation 'R4182:Gbp9'
ID319772
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Nameguanylate-binding protein 9
Synonyms
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105077630-105139539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105083595 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 375 (Q375L)
Ref Sequence ENSEMBL: ENSMUSP00000098521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031238
AA Change: Q375L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298
AA Change: Q375L

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
AA Change: Q375L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298
AA Change: Q375L

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199453
Meta Mutation Damage Score 0.5465 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105081264 missense probably benign 0.01
IGL00419:Gbp9 APN 5 105094077 missense probably benign 0.05
IGL00425:Gbp9 APN 5 105105754 missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105094498 missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105080206 missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105085172 splice site probably null
IGL01803:Gbp9 APN 5 105094173 missense probably damaging 1.00
IGL01803:Gbp9 APN 5 105085018 missense probably damaging 0.99
IGL02054:Gbp9 APN 5 105082807 missense probably benign 0.12
IGL02474:Gbp9 APN 5 105094567 splice site probably benign
IGL02633:Gbp9 APN 5 105083565 splice site probably benign
IGL02666:Gbp9 APN 5 105094275 splice site probably null
IGL02689:Gbp9 APN 5 105105796 missense probably benign 0.11
IGL02812:Gbp9 APN 5 105083758 missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105084953 missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105082786 missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105085073 missense probably benign 0.17
R1018:Gbp9 UTSW 5 105080260 missense probably benign 0.15
R1479:Gbp9 UTSW 5 105094064 splice site probably benign
R1655:Gbp9 UTSW 5 105081692 missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105094468 missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105094453 missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105081246 missense probably benign 0.01
R1986:Gbp9 UTSW 5 105105724 missense probably damaging 1.00
R1986:Gbp9 UTSW 5 105105786 missense probably damaging 0.98
R2124:Gbp9 UTSW 5 105094543 missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105094092 missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105080176 missense probably benign 0.02
R2997:Gbp9 UTSW 5 105082769 missense probably benign 0.00
R3745:Gbp9 UTSW 5 105105858 start gained probably benign
R4485:Gbp9 UTSW 5 105083808 missense probably damaging 0.97
R4718:Gbp9 UTSW 5 105083758 missense probably damaging 1.00
R5063:Gbp9 UTSW 5 105085162 missense probably benign
R5099:Gbp9 UTSW 5 105094513 missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105080141 missense probably benign 0.00
R5199:Gbp9 UTSW 5 105083812 missense probably benign 0.04
R5712:Gbp9 UTSW 5 105094555 missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105081258 missense probably benign 0.06
R5895:Gbp9 UTSW 5 105082858 missense probably damaging 1.00
R6360:Gbp9 UTSW 5 105083730 missense probably benign 0.03
R6646:Gbp9 UTSW 5 105082903 missense probably benign 0.13
R7559:Gbp9 UTSW 5 105085109 missense probably damaging 1.00
R7819:Gbp9 UTSW 5 105103879 missense possibly damaging 0.65
R8042:Gbp9 UTSW 5 105094242 missense probably damaging 1.00
R8288:Gbp9 UTSW 5 105105733 missense probably damaging 1.00
R8303:Gbp9 UTSW 5 105081305 missense possibly damaging 0.94
R8395:Gbp9 UTSW 5 105080203 missense probably damaging 1.00
R8397:Gbp9 UTSW 5 105083598 missense possibly damaging 0.94
Z1088:Gbp9 UTSW 5 105094125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCGCAGGACACTATATAC -3'
(R):5'- CGTGAGAACTCAGTAGCTGTGC -3'

Sequencing Primer
(F):5'- CGCAGGACACTATATACTCATTATTC -3'
(R):5'- CTCAGTAGCTGTGCAGAAGGC -3'
Posted On2015-06-10