Incidental Mutation 'R4331:Angptl2'
ID323585
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R4331 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33228748 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 178 (D178V)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect probably damaging
Transcript: ENSMUST00000004208
AA Change: D178V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: D178V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143252
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,227,679 Y301C probably damaging Het
Ahnak G A 19: 9,015,820 D4823N probably damaging Het
Capn8 A T 1: 182,604,454 D330V probably damaging Het
Clec16a T C 16: 10,571,669 V200A probably benign Het
Fcrla C T 1: 170,921,676 R96Q possibly damaging Het
Lrpprc A G 17: 84,740,542 probably null Het
Map4k5 A T 12: 69,827,374 S425T probably benign Het
Mthfsl A G 9: 88,688,781 V195A probably damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Plxna4 G A 6: 32,150,545 Q1876* probably null Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 A G 11: 116,602,296 Y375H probably damaging Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Ssc5d G A 7: 4,942,726 G919D probably benign Het
Vmn1r60 A T 7: 5,544,365 C245* probably null Het
Vmn2r103 T A 17: 19,794,233 M429K probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
grazie UTSW 2 33243910 nonsense probably null
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
R8719:Angptl2 UTSW 2 33243902 missense possibly damaging 0.74
R8928:Angptl2 UTSW 2 33242304 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCTGGAGCTGCTCAACAATG -3'
(R):5'- TCTGGATCTCATTGGTGGAAATC -3'

Sequencing Primer
(F):5'- AGATCGAGACGCTGCAGC -3'
(R):5'- GGAAATCTGGTTGATGATGCG -3'
Posted On2015-06-24